Free Full Text Journal Articles: Pharmacology -- Neurotransmitter.net

Recent Articles in PLoS Medicine / Public Libary of Science

Souza R, Yasuda S, Cristofani S
Treating schizophrenia with DOTS in developing countries: one size does not fit all.
PLoS Med. 2007 Sep 25;4(9):e281; author reply e285. [Abstract/Link to Full Text]

Patel V, Farooq S, Thara R
What is the best approach to treating schizophrenia in developing countries?
PLoS Med. 2007 Jun;4(6):e159.
BACKGROUND TO THE DEBATE: Schizophrenia affects an estimated 25 million people in low- and middle-income countries, with an average lifetime risk of about 1%. The illness is associated with excess mortality from a variety of causes. A 2001 Institute of Medicine report on mental illness in developing countries found that in 1990, over two-thirds of people with schizophrenia in these countries were not receiving any treatment (http://www.nap.edu/catalog/10111.html). The report found no evidence that the proportion of treated people in the developing world had increased since 1990. There is now a debate among mental health professionals in low-income countries over how best to improve patient care. In this article, three psychiatrists give their different viewpoints on the current status of treatment efforts for schizophrenia in the developing world and the measures that can be taken to increase the proportion of patients receiving treatment. [Abstract/Link to Full Text]

Kasi PM, Kassi M, Khawar T
Excessive work hours of physicians in training: maladaptive coping strategies.
PLoS Med. 2007 Sep 25;4(9):e279. [Abstract/Link to Full Text]

Fern�ndez Taylor KR
Excessive work hours of physicians in training in El Salvador: putting patients at risk.
PLoS Med. 2007 Jul;4(7):e205. [Abstract/Link to Full Text]

Braun L, Fausto-Sterling A, Fullwiley D, Hammonds EM, Nelson A, Quivers W, Reverby SM, Shields AE
Racial categories in medical practice: how useful are they?
PLoS Med. 2007 Sep 25;4(9):e271. [Abstract/Link to Full Text]

Ellison GT, Smart A, Tutton R, Outram SM, Ashcroft R, Martin P
Racial categories in medicine: a failure of evidence-based practice?
PLoS Med. 2007 Sep 25;4(9):e287. [Abstract/Link to Full Text]

Kurreeman FA, Padyukov L, Marques RB, Schrodi SJ, Seddighzadeh M, Stoeken-Rijsbergen G, van der Helm-van Mil AH, Allaart CF, Verduyn W, Houwing-Duistermaat J, Alfredsson L, Begovich AB, Klareskog L, Huizinga TW, Toes RE
A candidate gene approach identifies the TRAF1/C5 region as a risk factor for rheumatoid arthritis.
PLoS Med. 2007 Sep 18;4(9):e278.
BACKGROUND: Rheumatoid arthritis (RA) is a chronic autoimmune disorder affecting approximately 1% of the population. The disease results from the interplay between an individual's genetic background and unknown environmental triggers. Although human leukocyte antigens (HLAs) account for approximately 30% of the heritable risk, the identities of non-HLA genes explaining the remainder of the genetic component are largely unknown. Based on functional data in mice, we hypothesized that the immune-related genes complement component 5 (C5) and/or TNF receptor-associated factor 1 (TRAF1), located on Chromosome 9q33-34, would represent relevant candidate genes for RA. We therefore aimed to investigate whether this locus would play a role in RA. METHODS AND FINDINGS: We performed a multitiered case-control study using 40 single-nucleotide polymorphisms (SNPs) from the TRAF1 and C5 (TRAF1/C5) region in a set of 290 RA patients and 254 unaffected participants (controls) of Dutch origin. Stepwise replication of significant SNPs was performed in three independent sample sets from the Netherlands (ncases/controls = 454/270), Sweden (ncases/controls = 1,500/1,000) and US (ncases/controls = 475/475). We observed a significant association (p < 0.05) of SNPs located in a haplotype block that encompasses a 65 kb region including the 3' end of C5 as well as TRAF1. A sliding window analysis revealed an association peak at an intergenic region located approximately 10 kb from both C5 and TRAF1. This peak, defined by SNP14/rs10818488, was confirmed in a total of 2,719 RA patients and 1,999 controls (odds ratiocommon = 1.28, 95% confidence interval 1.17-1.39, pcombined = 1.40 x 10(-8)) with a population-attributable risk of 6.1%. The A (minor susceptibility) allele of this SNP also significantly correlates with increased disease progression as determined by radiographic damage over time in RA patients (p = 0.008). CONCLUSIONS: Using a candidate-gene approach we have identified a novel genetic risk factor for RA. Our findings indicate that a polymorphism in the TRAF1/C5 region increases the susceptibility to and severity of RA, possibly by influencing the structure, function, and/or expression levels of TRAF1 and/or C5. [Abstract/Link to Full Text]

Dworkin SL, Santelli J
Do abstinence-plus interventions reduce sexual risk behavior among youth?
PLoS Med. 2007 Sep 18;4(9):e276. [Abstract/Link to Full Text]

Underhill K, Operario D, Montgomery P
Systematic review of abstinence-plus HIV prevention programs in high-income countries.
PLoS Med. 2007 Sep 18;4(9):e275.
BACKGROUND: Abstinence-plus (comprehensive) interventions promote sexual abstinence as the best means of preventing HIV, but also encourage condom use and other safer-sex practices. Some critics of abstinence-plus programs have suggested that promoting safer sex along with abstinence may undermine abstinence messages or confuse program participants; conversely, others have suggested that promoting abstinence might undermine safer-sex messages. We conducted a systematic review to investigate the effectiveness of abstinence-plus interventions for HIV prevention among any participants in high-income countries as defined by the World Bank. METHODS AND FINDINGS: Cochrane Collaboration systematic review methods were used. We included randomized and quasi-randomized controlled trials of abstinence-plus programs for HIV prevention among any participants in any high-income country; trials were included if they reported behavioural or biological outcomes. We searched 30 electronic databases without linguistic or geographical restrictions to February 2007, in addition to contacting experts, hand-searching conference abstracts, and cross-referencing papers. After screening 20,070 abstracts and 325 full published and unpublished papers, we included 39 trials that included approximately 37,724 North American youth. Programs were based in schools (10), community facilities (24), both schools and community facilities (2), health care facilities (2), and family homes (1). Control groups varied. All outcomes were self-reported. Quantitative synthesis was not possible because of heterogeneity across trials in programs and evaluation designs. Results suggested that many abstinence-plus programs can reduce HIV risk as indicated by self-reported sexual behaviours. Of 39 trials, 23 found a protective program effect on at least one sexual behaviour, including abstinence, condom use, and unprotected sex (baseline n = 19,819). No trial found adverse program effects on any behavioural outcome, including incidence of sex, frequency of sex, sexual initiation, or condom use. This suggests that abstinence-plus approaches do not undermine program messages encouraging abstinence, nor do they undermine program messages encouraging safer sex. Findings consistently favoured abstinence-plus programs over controls for HIV knowledge outcomes, suggesting that abstinence-plus programs do not confuse participants. Results for biological outcomes were limited by floor effects. Three trials assessed self-reported diagnosis or treatment of sexually transmitted infection; none found significant effects. Limited evidence from seven evaluations suggested that some abstinence-plus programs can reduce pregnancy incidence. No trial observed an adverse biological program effect. CONCLUSIONS: Many abstinence-plus programs appear to reduce short-term and long-term HIV risk behaviour among youth in high-income countries. Programs did not cause harm. Although generalisability may be somewhat limited to North American adolescents, these findings have critical implications for abstinence-based HIV prevention policies. Suggestions are provided for improving the conduct and reporting of trials of abstinence-plus and other behavioural interventions to prevent HIV. [Abstract/Link to Full Text]

Gernburd P, Jadad AR
Will spam overwhelm our defenses? Evaluating offerings for drugs and natural health products.
PLoS Med. 2007 Sep 18;4(9):e274. [Abstract/Link to Full Text]

Tindana PO, Singh JA, Tracy CS, Upshur RE, Daar AS, Singer PA, Frohlich J, Lavery JV
Grand challenges in global health: community engagement in research in developing countries.
PLoS Med. 2007 Sep 11;4(9):e273. [Abstract/Link to Full Text]

Bhan A, Singh JA, Upshur RE, Singer PA, Daar AS
Grand challenges in global health: engaging civil society organizations in biomedical research in developing countries.
PLoS Med. 2007 Sep 11;4(9):e272. [Abstract/Link to Full Text]

Berndtson K, Daid T, Tracy CS, Bhan A, Cohen ER, Upshur RE, Singh JA, Daar AS, Lavery JV, Singer PA
Grand challenges in global health: ethical, social, and cultural issues based on key informant perspectives.
PLoS Med. 2007 Sep 11;4(9):e268. [Abstract/Link to Full Text]

Singer PA, Taylor AD, Daar AS, Upshur RE, Singh JA, Lavery JV
Grand challenges in global health: the ethical, social and cultural program.
PLoS Med. 2007 Sep 11;4(9):e265. [Abstract/Link to Full Text]

Di Angelantonio E, Danesh J, Eiriksdottir G, Gudnason V
Renal function and risk of coronary heart disease in general populations: new prospective study and systematic review.
PLoS Med. 2007 Sep 4;4(9):e270.
BACKGROUND: End-stage chronic kidney disease is associated with striking excesses of cardiovascular mortality, but it is uncertain to what extent renal function is related to risk of subsequent coronary heart disease (CHD) in apparently healthy adults. This study aims to quantify the association of markers of renal function with CHD risk in essentially general populations. METHODS AND FINDINGS: Estimated glomerular filtration rate (eGFR) was calculated using standard prediction equations based on serum creatinine measurements made in 2,007 patients diagnosed with nonfatal myocardial infarction or coronary death during follow-up and in 3,869 people without CHD in the Reykjavik population-based cohort of 18,569 individuals. There were small and nonsignificant odds ratios (ORs) for CHD risk over most of the range in eGFR, except in the lowest category of the lowest fifth (corresponding to values of <60 ml/min/1.73 m2), in which the OR was 1.33 (95% confidence interval 1.01-1.75) after adjustment for several established cardiovascular risk factors. Findings from the Reykjavik study were reinforced by a meta-analysis of six previous reports (identified in electronic and other databases) involving a total of 4,720 incident CHD cases (including Reykjavik), which yielded a combined risk ratio of 1.41 (95% confidence interval 1.19-1.68) in individuals with baseline eGFR less than 60 ml/min/1.73 m2 compared with those with higher values. CONCLUSIONS: Although there are no strong associations between lower-than-average eGFR and CHD risk in apparently healthy adults over most of the range in renal function, there may be a moderate increase in CHD risk associated with very low eGFR (i.e., renal dysfunction) in the general population. These findings could have implications for the further understanding of CHD and targeting cardioprotective interventions. [Abstract/Link to Full Text]

Mei SH, McCarter SD, Deng Y, Parker CH, Liles WC, Stewart DJ
Prevention of LPS-induced acute lung injury in mice by mesenchymal stem cells overexpressing angiopoietin 1.
PLoS Med. 2007 Sep 4;4(9):e269.
BACKGROUND: The acute respiratory distress syndrome (ARDS), a clinical complication of severe acute lung injury (ALI) in humans, is a leading cause of morbidity and mortality in critically ill patients. ALI is characterized by disruption of the lung alveolar-capillary membrane barrier and resultant pulmonary edema associated with a proteinaceous alveolar exudate. Current specific treatment strategies for ALI/ARDS are lacking. We hypothesized that mesenchymal stem cells (MSCs), with or without transfection with the vasculoprotective gene angiopoietin 1 (ANGPT1) would have beneficial effects in experimental ALI in mice. METHODS AND FINDINGS: Syngeneic MSCs with or without transfection with plasmid containing the human ANGPT1 gene (pANGPT1) were delivered through the right jugular vein of mice 30 min after intratracheal instillation of lipopolysaccharide (LPS) to induce lung injury. Administration of MSCs significantly reduced LPS-induced pulmonary inflammation, as reflected by reductions in total cell and neutrophil counts in bronchoalveolar lavage (BAL) fluid (53%, 95% confidence interval [CI] 7%-101%; and 60%, CI 4%-116%, respectively) as well as reducing levels of proinflammatory cytokines in both BAL fluid and lung parenchymal homogenates. Furthermore, administration of MSCs transfected with pANGPT1 resulted in nearly complete reversal of LPS-induced increases in lung permeability as assessed by reductions in IgM and albumin levels in BAL (96%, CI 6%-185%; and 74%, CI 23%-126%, respectively). Fluorescently tagged MSCs were detected in the lung tissues by confocal microscopy and flow cytometry in both na�ve and LPS-injured animals up to 3 d. CONCLUSIONS: Treatment with MSCs alone significantly reduced LPS-induced acute pulmonary inflammation in mice, while administration of pANGPT1-transfected MSCs resulted in a further improvement in both alveolar inflammation and permeability. These results suggest a potential role for cell-based ANGPT1 gene therapy to treat clinical ALI/ARDS. [Abstract/Link to Full Text]

Aarabi S, Longaker MT, Gurtner GC
Hypertrophic scar formation following burns and trauma: new approaches to treatment.
PLoS Med. 2007 Sep 4;4(9):e234. [Abstract/Link to Full Text]

Lawlor DA, Fraser A, Ebrahim S, Smith GD
Independent associations of fasting insulin, glucose, and glycated haemoglobin with stroke and coronary heart disease in older women.
PLoS Med. 2007 Aug 28;4(8):e263.
BACKGROUND: Evidence suggests that variations in fasting glucose and insulin amongst those without frank type 2 diabetes mellitus are important determinants of cardiovascular disease. However, the relative importance of variations in fasting insulin, glucose, and glycated haemoglobin as risk factors for cardiovascular disease in women without diabetes is unclear. Our aim was to determine the independent associations of fasting insulin, glucose, and glycated haemoglobin with coronary heart disease and stroke in older women. METHODS AND FINDINGS: We undertook a prospective cohort study of 3,246 British women aged 60-79 y, all of whom were free of baseline coronary heart disease, stroke, and diabetes, and all of whom had fasting glucose levels below 7 mmol/l. Fasting insulin and homeostasis model assessment for insulin sensitivity (HOMA-S) were linearly associated with a combined outcome of coronary heart disease or stroke (n = 219 events), but there was no association of fasting glucose or glycated haemoglobin with these outcomes. Results were similar for coronary heart disease and stroke as separate outcomes. The age, life-course socioeconomic position, smoking, and physical activity adjusted hazard ratio for a combined outcome of incident coronary heart disease or stroke per one standard deviation of fasting insulin was 1.14 (95% CI 1.02-1.33). Additional adjustment for other components of metabolic syndrome, low-density lipoprotein cholesterol, fasting glucose, and glycated haemoglobin had little effect on this result. CONCLUSIONS: Our findings suggest that in women in the 60-79 y age range, insulin resistance, rather than insulin secretion or chronic hyperglycaemia, is a more important risk factor for coronary heart disease and stroke. Below currently used thresholds of fasting glucose for defining diabetes, neither fasting glucose nor glycated haemoglobin are associated with cardiovascular disease. [Abstract/Link to Full Text]

Hemming ML, Patterson M, Reske-Nielsen C, Lin L, Isacson O, Selkoe DJ
Reducing amyloid plaque burden via ex vivo gene delivery of an Abeta-degrading protease: a novel therapeutic approach to Alzheimer disease.
PLoS Med. 2007 Aug 28;4(8):e262.
BACKGROUND: Understanding the mechanisms of amyloid-beta protein (Abeta) production and clearance in the brain has been essential to elucidating the etiology of Alzheimer disease (AD). Chronically decreasing brain Abeta levels is an emerging therapeutic approach for AD, but no such disease-modifying agents have achieved clinical validation. Certain proteases are responsible for the catabolism of brain Abeta in vivo, and some experimental evidence suggests they could be used as therapeutic tools to reduce Abeta levels in AD. The objective of this study was to determine if enhancing the clearance of Abeta in the brain by ex vivo gene delivery of an Abeta-degrading protease can reduce amyloid plaque burden. METHODS AND FINDINGS: We generated a secreted form of the Abeta-degrading protease neprilysin, which significantly lowers the levels of naturally secreted Abeta in cell culture. We then used an ex vivo gene delivery approach utilizing primary fibroblasts to introduce this soluble protease into the brains of beta-amyloid precursor protein (APP) transgenic mice with advanced plaque deposition. Brain examination after cell implantation revealed robust clearance of plaques at the site of engraftment (72% reduction, p = 0.0269), as well as significant reductions in plaque burden in both the medial and lateral hippocampus distal to the implantation site (34% reduction, p = 0.0020; and 55% reduction, p = 0.0081, respectively). CONCLUSIONS: Ex vivo gene delivery of an Abeta-degrading protease reduces amyloid plaque burden in transgenic mice expressing human APP. These results support the use of Abeta-degrading proteases as a means to therapeutically lower Abeta levels and encourage further exploration of ex vivo gene delivery for the treatment of Alzheimer disease. [Abstract/Link to Full Text]

de Munter JS, Hu FB, Spiegelman D, Franz M, van Dam RM
Whole grain, bran, and germ intake and risk of type 2 diabetes: a prospective cohort study and systematic review.
PLoS Med. 2007 Aug 28;4(8):e261.
BACKGROUND: Control of body weight by balancing energy intake and energy expenditure is of major importance for the prevention of type 2 diabetes, but the role of specific dietary factors in the etiology of type 2 diabetes is less well established. We evaluated intakes of whole grain, bran, and germ in relation to risk of type 2 diabetes in prospective cohort studies. METHODS AND FINDINGS: We followed 161,737 US women of the Nurses' Health Studies (NHSs) I and II, without history of diabetes, cardiovascular disease, or cancer at baseline. The age at baseline was 37-65 y for NHSI and 26-46 y for NHSII. Dietary intakes and potential confounders were assessed with regularly administered questionnaires. We documented 6,486 cases of type 2 diabetes during 12-18 y of follow-up. Other prospective cohort studies on whole grain intake and risk of type 2 diabetes were identified in searches of MEDLINE and EMBASE up to January 2007, and data were independently extracted by two reviewers. The median whole grain intake in the lowest and highest quintile of intake was, respectively, 3.7 and 31.2 g/d for NHSI and 6.2 and 39.9 g/d for NHSII. After adjustment for potential confounders, the relative risks (RRs) for the highest as compared with the lowest quintile of whole grain intake was 0.63 (95% confidence interval [CI] 0.57-0.69) for NHSI and 0.68 (95% CI 0.57-0.81) for NHSII (both: p-value, test for trend <0.001). After further adjustment for body mass index (BMI), these RRs were 0.75 (95% CI 0.68-0.83; p-value, test for trend <0.001) and 0.86 (95% CI 0.72-1.02; p-value, test for trend 0.03) respectively. Associations for bran intake were similar to those for total whole grain intake, whereas no significant association was observed for germ intake after adjustment for bran. Based on pooled data for six cohort studies including 286,125 participants and 10,944 cases of type 2 diabetes, a two-serving-per-day increment in whole grain consumption was associated with a 21% (95% CI 13%-28%) decrease in risk of type 2 diabetes after adjustment for potential confounders and BMI. CONCLUSIONS: Whole grain intake is inversely associated with risk of type 2 diabetes, and this association is stronger for bran than for germ. Findings from prospective cohort studies consistently support increasing whole grain consumption for the prevention of type 2 diabetes. [Abstract/Link to Full Text]

Tomlinson M, Chopra M, Sanders D, Bradshaw D, Hendricks M, Greenfield D, Black RE, El Arifeen S, Rudan I
Setting priorities in child health research investments for South Africa.
PLoS Med. 2007 Aug 28;4(8):e259. [Abstract/Link to Full Text]

Qualitative research: understanding patients' needs and experiences.
PLoS Med. 2007 Aug 28;4(8):e258. [Abstract/Link to Full Text]

Anstey NM, Price RN
Improving case definitions for severe malaria.
PLoS Med. 2007 Aug 21;4(8):e267. [Abstract/Link to Full Text]

Bejon P, Berkley JA, Mwangi T, Ogada E, Mwangi I, Maitland K, Williams T, Scott JA, English M, Lowe BS, Peshu N, Newton CR, Marsh K
Defining childhood severe falciparum malaria for intervention studies.
PLoS Med. 2007 Aug 21;4(8):e251.
BACKGROUND: Clinical trials of interventions designed to prevent severe falciparum malaria in children require a clear endpoint. The internationally accepted definition of severe malaria is sensitive, and appropriate for clinical purposes. However, this definition includes individuals with severe nonmalarial disease and coincident parasitaemia, so may lack specificity in vaccine trials. Although there is no "gold standard" individual test for severe malaria, malaria-attributable fractions (MAFs) can be estimated among groups of children using a logistic model, which we use to test the suitability of various case definitions as trial endpoints. METHODS AND FINDINGS: A total of 4,583 blood samples were taken from well children in cross-sectional surveys and from 1,361 children admitted to a Kenyan District hospital with severe disease. Among children under 2 y old with severe disease and over 2,500 parasites per microliter of blood, the MAFs were above 85% in moderate- and low-transmission areas, but only 61% in a high-transmission area. HIV and malnutrition were not associated with reduced MAFs, but gastroenteritis with severe dehydration (defined by reduced skin turgor), lower respiratory tract infection (clinician's final diagnosis), meningitis (on cerebrospinal fluid [CSF] examination), and bacteraemia were associated with reduced MAFs. The overall MAF was 85% (95% confidence interval [CI] 83.8%-86.1%) without excluding these conditions, 89% (95% CI 88.4%-90.2%) after exclusions, and 95% (95% CI 94.0%-95.5%) when a threshold of 2,500 parasites/mul was also applied. Applying a threshold and exclusion criteria reduced sensitivity to 80% (95% CI 77%-83%). CONCLUSIONS: The specificity of a case definition for severe malaria is improved by applying a parasite density threshold and by excluding children with meningitis, lower respiratory tract infection (clinician's diagnosis), bacteraemia, and gastroenteritis with severe dehydration, but not by excluding children with HIV or malnutrition. [Abstract/Link to Full Text]

Tonwe-Gold B, Ekouevi DK, Viho I, Amani-Bosse C, Toure S, Coffie PA, Rouet F, Becquet R, Leroy V, El-Sadr WM, Abrams EJ, Dabis F
Antiretroviral treatment and prevention of peripartum and postnatal HIV transmission in West Africa: evaluation of a two-tiered approach.
PLoS Med. 2007 Aug 21;4(8):e257.
BACKGROUND: Highly active antiretroviral treatment (HAART) has only been recently recommended for HIV-infected pregnant women requiring treatment for their own health in resource-limited settings. However, there are few documented experiences from African countries. We evaluated the short-term (4 wk) and long-term (12 mo) effectiveness of a two-tiered strategy of prevention of mother-to-child transmission of HIV (PMTCT) in Africa: women meeting the eligibility criteria of the World Health Organization (WHO) received HAART, and women with less advanced HIV disease received short-course antiretroviral (scARV) PMTCT regimens. METHODS AND FINDINGS: The MTCT-Plus Initiative is a multi-country, family-centred HIV care and treatment program for pregnant and postpartum women and their families. Pregnant women enrolled in Abidjan, C�te d'Ivoire received either HAART for their own health or short-course antiretroviral (scARV) PMTCT regimens according to their clinical and immunological status. Plasma HIV-RNA viral load (VL) was measured to diagnose peripartum infection when infants were 4 wk of age, and HIV final status was documented either by rapid antibody testing when infants were aged > or = 12 mo or by plasma VL earlier. The Kaplan-Meier method was used to estimate the rate of HIV transmission and HIV-free survival. Between August 2003 and June 2005, 107 women began HAART at a median of 30 wk of gestation, 102 of them with zidovudine (ZDV), lamivudine (3TC), and nevirapine (NVP) and they continued treatment postpartum; 143 other women received scARV for PMTCT, 103 of them with sc(ZDV+3TC) with single-dose NVP during labour. Most (75%) of the infants were breast-fed for a median of 5 mo. Overall, the rate of peripartum HIV transmission was 2.2% (95% confidence interval [CI] 0.3%-4.2%) and the cumulative rate at 12 mo was 5.7% (95% CI 2.5%-9.0%). The overall probability of infant death or infection with HIV was 4.3% (95% CI 1.7%-7.0%) at age week 4 wk and 11.7% (95% CI 7.5%-15.9%) at 12 mo. CONCLUSIONS: This two-tiered strategy appears to be safe and highly effective for short- and long-term PMTCT in resource-constrained settings. These results indicate a further benefit of access to HAART for pregnant women who need treatment for their own health. [Abstract/Link to Full Text]

Smith TC, Novella SP
HIV denial in the Internet era.
PLoS Med. 2007 Aug 21;4(8):e256. [Abstract/Link to Full Text]

Noor AM, Amin AA, Akhwale WS, Snow RW
Increasing coverage and decreasing inequity in insecticide-treated bed net use among rural Kenyan children.
PLoS Med. 2007 Aug 21;4(8):e255.
BACKGROUND: Inexpensive and efficacious interventions that avert childhood deaths in sub-Saharan Africa have failed to reach effective coverage, especially among the poorest rural sectors. One particular example is insecticide-treated bed nets (ITNs). In this study, we present repeat observations of ITN coverage among rural Kenyan homesteads exposed at different times to a range of delivery models, and assess changes in coverage across socioeconomic groups. METHODS AND FINDINGS: We undertook a study of annual changes in ITN coverage among a cohort of 3,700 children aged 0-4 y in four districts of Kenya (Bondo, Greater Kisii, Kwale, and Makueni) annually between 2004 and 2006. Cross-sectional surveys of ITN coverage were undertaken coincidentally with the incremental availability of commercial sector nets (2004), the introduction of heavily subsidized nets through clinics (2005), and the introduction of free mass distributed ITNs (2006). The changing prevalence of ITN coverage was examined with special reference to the degree of equity in each delivery approach. ITN coverage was only 7.1% in 2004 when the predominant source of nets was the commercial retail sector. By the end of 2005, following the expansion of heavily subsidized clinic distribution system, ITN coverage rose to 23.5%. In 2006 a large-scale mass distribution of ITNs was mounted providing nets free of charge to children, resulting in a dramatic increase in ITN coverage to 67.3%. With each subsequent survey socioeconomic inequity in net coverage sequentially decreased: 2004 (most poor [2.9%] versus least poor [15.6%]; concentration index 0.281); 2005 (most poor [17.5%] versus least poor [37.9%]; concentration index 0.131), and 2006 with near-perfect equality (most poor [66.3%] versus least poor [66.6%]; concentration index 0.000). The free mass distribution method achieved highest coverage among the poorest children, the highly subsidised clinic nets programme was marginally in favour of the least poor, and the commercial social marketing favoured the least poor. CONCLUSIONS: Rapid scaling up of ITN coverage among Africa's poorest rural children can be achieved through mass distribution campaigns. These efforts must form an important adjunct to regular, routine access to ITNs through clinics, and each complimentary approach should aim to make this intervention free to clients to ensure equitable access among those least able to afford even the cost of a heavily subsidized net. [Abstract/Link to Full Text]

Low-Beer D, Afkhami H, Komatsu R, Banati P, Sempala M, Katz I, Cutler J, Schumacher P, Tran-Ba-Huy R, Schwartl�nder B
Making performance-based funding work for health.
PLoS Med. 2007 Aug 21;4(8):e219. [Abstract/Link to Full Text]

Senechal B, Elain G, Jeziorski E, Grondin V, Patey-Mariaud de Serre N, Jaubert F, Beldjord K, Lellouch A, Glorion C, Zerah M, Mary P, Barkaoui M, Emile JF, Boccon-Gibod L, Josset P, Debr� M, Fischer A, Donadieu J, Geissmann F
Expansion of regulatory T cells in patients with Langerhans cell histiocytosis.
PLoS Med. 2007 Aug 14;4(8):e253.
BACKGROUND: Langerhans cell histiocytosis (LCH) is a rare clonal granulomatous disease that affects mainly children. LCH can involve various tissues such as bone, skin, lung, bone marrow, lymph nodes, and the central nervous system, and is frequently responsible for functional sequelae. The pathophysiology of LCH is unclear, but the uncontrolled proliferation of Langerhans cells (LCs) is believed to be the primary event in the formation of granulomas. The present study was designed to further investigate the nature of proliferating cells and the immune mechanisms involved in the LCH granulomas. METHODS AND FINDINGS: Biopsies (n = 24) and/or blood samples (n = 25) from 40 patients aged 0.25 to 13 y (mean 7.8 y), were studied to identify cells that proliferate in blood and granulomas. We found that the proliferating index of LCs was low ( approximately 1.9%), and we did not observe expansion of a monocyte or dendritic cell compartment in patients. We found that LCH lesions were a site of active inflammation, tissue remodeling, and neo-angiogenesis, and the majority of proliferating cells were endothelial cells, fibroblasts, and polyclonal T lymphocytes. Within granulomas, interleukin 10 was abundant, LCs expressed the TNF receptor family member RANK, and CD4(+) CD25(high) FoxP3(high) regulatory T cells (T-regs) represented 20% of T cells, and were found in close contact with LCs. FoxP3(+) T-regs were also expanded compared to controls, in the blood of LCH patients with active disease, among whom seven out of seven tested exhibited an impaired skin delayed-type hypersensitivity response. In contrast, the number of blood T-regs were normal after remission of LCH. CONCLUSIONS: These findings indicate that LC accumulation in LCH results from survival rather than uncontrolled proliferation, and is associated with the expansion of T-regs. These data suggest that LCs may be involved in the expansion of T-regs in vivo, resulting in the failure of the host immune system to eliminate LCH cells. Thus T-regs could be a therapeutic target in LCH. [Abstract/Link to Full Text]

Bates I, McKew S, Sarkinfada F
Anaemia: a useful indicator of neglected disease burden and control.
PLoS Med. 2007 Aug 14;4(8):e231. [Abstract/Link to Full Text]

Swen JJ, Huizinga TW, Gelderblom H, de Vries EG, Assendelft WJ, Kirchheiner J, Guchelaar HJ
Translating pharmacogenomics: challenges on the road to the clinic.
PLoS Med. 2007 Aug 14;4(8):e209.
Pharmacogenomics is one of the first clinical applications of the postgenomic era. It promises personalized medicine rather than the established "one size fits all" approach to drugs and dosages. The expected reduction in trial and error should ultimately lead to more efficient and safer drug therapy. In recent years, commercially available pharmacogenomic tests have been approved by the Food and Drug Administration (FDA), but their application in patient care remains very limited. More generally, the implementation of pharmacogenomics in routine clinical practice presents significant challenges. This article presents specific clinical examples of such challenges and discusses how obstacles to implementation of pharmacogenomic testing can be addressed. [Abstract/Link to Full Text]

Ramjee G, Govinden R, Morar NS, Mbewu A
South Africa's experience of the closure of the cellulose sulphate microbicide trial.
PLoS Med. 2007 Jul;4(7):e235. [Abstract/Link to Full Text]

Brennan MJ, Fruth U, Milstien J, Tiernan R, de Andrade Nishioka S, Chocarro L
Development of new tuberculosis vaccines: a global perspective on regulatory issues.
PLoS Med. 2007 Aug 7;4(8):e252. [Abstract/Link to Full Text]

McAlister FA, van Diepen S, Padwal RS, Johnson JA, Majumdar SR
How evidence-based are the recommendations in evidence-based guidelines?
PLoS Med. 2007 Aug 7;4(8):e250.
BACKGROUND: Treatment recommendations for the same condition from different guideline bodies often disagree, even when the same randomized controlled trial (RCT) evidence is cited. Guideline appraisal tools focus on methodology and quality of reporting, but not on the nature of the supporting evidence. This study was done to evaluate the quality of the evidence (based on consideration of its internal validity, clinical relevance, and applicability) underlying therapy recommendations in evidence-based clinical practice guidelines. METHODS AND FINDINGS: A cross-sectional analysis of cardiovascular risk management recommendations was performed for three different conditions (diabetes mellitus, dyslipidemia, and hypertension) from three pan-national guideline panels (from the United States, Canada, and Europe). Of the 338 treatment recommendations in these nine guidelines, 231 (68%) cited RCT evidence but only 105 (45%) of these RCT-based recommendations were based on high-quality evidence. RCT-based evidence was downgraded most often because of reservations about the applicability of the RCT to the populations specified in the guideline recommendation (64/126 cases, 51%) or because the RCT reported surrogate outcomes (59/126 cases, 47%). CONCLUSIONS: The results of internally valid RCTs may not be applicable to the populations, interventions, or outcomes specified in a guideline recommendation and therefore should not always be assumed to provide high-quality evidence for therapy recommendations. [Abstract/Link to Full Text]

Olson DR, Heffernan RT, Paladini M, Konty K, Weiss D, Mostashari F
Monitoring the impact of influenza by age: emergency department fever and respiratory complaint surveillance in New York City.
PLoS Med. 2007 Aug 7;4(8):e247.
BACKGROUND: The importance of understanding age when estimating the impact of influenza on hospitalizations and deaths has been well described, yet existing surveillance systems have not made adequate use of age-specific data. Monitoring influenza-related morbidity using electronic health data may provide timely and detailed insight into the age-specific course, impact and epidemiology of seasonal drift and reassortment epidemic viruses. The purpose of this study was to evaluate the use of emergency department (ED) chief complaint data for measuring influenza-attributable morbidity by age and by predominant circulating virus. METHODS AND FINDINGS: We analyzed electronically reported ED fever and respiratory chief complaint and viral surveillance data in New York City (NYC) during the 2001-2002 through 2005-2006 influenza seasons, and inferred dominant circulating viruses from national surveillance reports. We estimated influenza-attributable impact as observed visits in excess of a model-predicted baseline during influenza periods, and epidemic timing by threshold and cross correlation. We found excess fever and respiratory ED visits occurred predominantly among school-aged children (8.5 excess ED visits per 1,000 children aged 5-17 y) with little or no impact on adults during the early-2002 B/Victoria-lineage epidemic; increased fever and respiratory ED visits among children younger than 5 y during respiratory syncytial virus-predominant periods preceding epidemic influenza; and excess ED visits across all ages during the 2003-2004 (9.2 excess visits per 1,000 population) and 2004-2005 (5.2 excess visits per 1,000 population) A/H3N2 Fujian-lineage epidemics, with the relative impact shifted within and between seasons from younger to older ages. During each influenza epidemic period in the study, ED visits were increased among school-aged children, and each epidemic peaked among school-aged children before other impacted age groups. CONCLUSIONS: Influenza-related morbidity in NYC was highly age- and strain-specific. The impact of reemerging B/Victoria-lineage influenza was focused primarily on school-aged children born since the virus was last widespread in the US, while epidemic A/Fujian-lineage influenza affected all age groups, consistent with a novel antigenic variant. The correspondence between predominant circulating viruses and excess ED visits, hospitalizations, and deaths shows that excess fever and respiratory ED visits provide a reliable surrogate measure of incident influenza-attributable morbidity. The highly age-specific impact of influenza by subtype and strain suggests that greater age detail be incorporated into ongoing surveillance. Influenza morbidity surveillance using electronic data currently available in many jurisdictions can provide timely and representative information about the age-specific epidemiology of circulating influenza viruses. [Abstract/Link to Full Text]

Montori VM, Breslin M, Maleska M, Weymiller AJ
Creating a conversation: insights from the development of a decision aid.
PLoS Med. 2007 Aug 7;4(8):e233. [Abstract/Link to Full Text]

Recent Articles in BMC Medicine

Kasper S, Anghelescu IG, Szegedi A, Dienel A, Kieser M
Superior efficacy of St John's wort extract WS 5570 compared to placebo in patients with major depression: a randomized, double-blind, placebo-controlled, multi-center trial [ISRCTN77277298].
BMC Med. 2006;414.
BACKGROUND: The aim of the current study was to assess the antidepressant efficacy and safety of Hypericum perforatum (St. John's wort) extract WS 5570 at doses of 600 mg/day in a single dose and 1200 mg/day in two doses. METHODS: The participants in this double-blind, randomized, placebo-controlled, multi-center clinical trial were male and female adult out-patients with an episode of mild or moderate major depressive episode (single or recurrent episode, DSM-IV criteria). As specified by the relevant guideline, the study was preceded by a medication-free run-in phase. For the 6-week treatment, 332 patients were randomized: 123 to WS 5570 600 mg/day, 127 to WS 5570 1200 mg/day, and 82 to placebo. The primary outcome measure was the change in total score on the Hamilton Rating Scale for Depression (HAM-D, 17-item version) between baseline and endpoint. Additional measures included the number of responders, the number of patients in remission, and several other standard rating scales. Efficacy and safety were assessed after 2 and 6 weeks. The design included an interim analysis performed after randomization with the option of early termination. RESULTS: After 6 weeks of treatment, mean +/- standard deviation decreases in HAM-D total scores of 11.6 +/- 6.4, 10.8 +/- 7.3, and 6.0 +/- 8.1 points were observed for the WS 5570 600 mg/day, 1200 mg/day and placebo groups, respectively (endpoint analysis). Secondary measures of treatment efficacy also showed that both WS 5570 groups were statistically superior to placebo. Significantly more patients in the WS 5570 treatment groups than in the placebo group showed treatment response and remission. WS 5570 was consistently more effective than placebo in patients with either less severe or more severe baseline impairment. The number of patients who experienced remission was higher in the WS 5570 1200 mg/day group than the WS 5570 600 mg/day group. The incidence of adverse events was low in all groups. The adverse event profile was consistent with the known profile for Hypericum extract preparations. CONCLUSION: Hypericum perforatum extract WS 5570 at doses of 600 mg/day (once daily) and 1200 mg/day (600 mg twice daily) were found to be safe and more effective than placebo, with comparable efficacy of the WS 5570 groups for the treatment of mild to moderate major depression. [Abstract/Link to Full Text]

Wager E, Parkin EC, Tamber PS
Are reviewers suggested by authors as good as those chosen by editors? Results of a rater-blinded, retrospective study.
BMC Med. 2006;413.
BACKGROUND: BioMed Central (BMC) requires authors to suggest four reviewers when making a submission. Editors searching for reviewers use these suggestions as a source. The review process of the medical journals in the BMC series is open--authors and reviewers know each other's identity--although reviewers can make confidential comments to the editor. Reviews are published alongside accepted articles so readers may see the reviewers' names and recommendations.Our objective was to compare the performance of author-nominated reviewers (ANR) with that of editor-chosen reviewers (ECR) in terms of review quality and recommendations about submissions in an online-only medical journal. METHODS: Pairs of reviews from 100 consecutive submissions to medical journals in the BMC series (with one author-nominated and one editor-chosen reviewer and a final decision) were assessed by two raters, blinded to reviewer type, using a validated review quality instrument (RQI) which rates 7 items on 5-point Likert scales. The raters discussed their ratings after the first 20 pairs (keeping reviewer type masked) and resolved major discrepancies in scoring and interpretation to improve inter-rater reliability. Reviewers' recommendations were also compared. RESULTS: Reviewer source had no impact on review quality (mean RQI score (+/- SD) 2.24 +/- 0.55 for ANR, 2.34 +/- 0.54 for ECR) or tone (mean scores on additional question 2.72 ANR vs 2.82 ECR) (maximum score = 5 in both cases). However author-nominated reviewers were significantly more likely to recommend acceptance (47 vs 35) and less likely to recommend rejection (10 vs 23) than editor-chosen reviewers after initial review (p < 0.001). However, by the final review stage (i.e. after authors had responded to reviewer comments) ANR and ECR recommendations were similar (65 vs 66 accept, 10 vs 14 reject, p = 0.47). The number of reviewers unable to decide about acceptance was similar in both groups at both review stages. CONCLUSION: Author-nominated reviewers produced reviews of similar quality to editor-chosen reviewers but were more likely to recommend acceptance during the initial stages of peer review. [Abstract/Link to Full Text]

Lim E, Cornelissen J, Routledge T, Ali A, Kirtland S, Sharples L, Sheridan K, Bellm S, Munday H, Large S
Biological efficacy of low versus medium dose aspirin after coronary surgery: results from a randomized trial [NCT00262275].
BMC Med. 2006;412.
BACKGROUND: The beneficial effect of aspirin after coronary surgery is established; however, a recent study reported the inability of low doses (100 mg) to inhibit postoperative platelet function. We conducted a double-blind randomised trial to establish the efficacy of low dose aspirin and to compare it against medium dose aspirin. METHODS: Patients undergoing coronary surgery were invited to participate and consenting patients were randomised to 100 mg or 325 mg of aspirin daily for 5 days. Our primary outcome was the difference in platelet aggregation (day 5 - baseline) using 1 microg/ml of collagen. Secondary outcomes were differences in EC50 of collagen, ADP and epinephrine (assessed using the technique of Born). RESULTS: From September 2002 to April 2004, 72 patients were randomised; 3 patients discontinued, leaving 35 and 34 in the low and medium dose aspirin arms respectively. The mean aggregation (using 1.1 microg/ml of collagen) was reduced in both the medium and low dose aspirin arms by 37% and 36% respectively. The baseline adjusted difference (low - medium) was 6% (95% CI -3 to 14; p = 0.19). The directions of the results for the differences in EC50 (low - medium) were consistent for collagen, ADP and epinephrine at -0.07 (-0.53 to 0.40), -0.08 (-0.28 to 0.11) and -4.41 (-10.56 to 1.72) respectively, but none were statistically significant. CONCLUSION : Contrary to recent findings, low dose aspirin is effective and medium dose aspirin did not prove superior for inhibiting platelet aggregation after coronary surgery. [Abstract/Link to Full Text]

Lemyre B, Sherlock R, Hogan D, Gaboury I, Blanchard C, Moher D
How effective is tetracaine 4% gel, before a peripherally inserted central catheter, in reducing procedural pain in infants: a randomized double-blind placebo controlled trial [ISRCTN75884221].
BMC Med. 2006;411.
BACKGROUND: Procedural pain relief is sub-optimal in infants, especially small and vulnerable ones. Tetracaine gel 4% (Ametop, Smith-Nephew) provides pain relief in children and larger infants, but its efficacy in smaller infants and for peripherally inserted central catheters (PICC) remains uncertain. The objective of this trial was to assess the safety and efficacy of tetracaine gel on the pain response of very low birth weight (VLBW) infants during insertion of a PICC. METHODS: Medically stable infants greater than or equal to 24 weeks gestation, requiring a non-urgent PICC, were included. Following randomization and double blinding, 1.1 g of tetracaine or placebo was applied to the skin for 30 minutes. The PICC was inserted according to a standard protocol. Pain was assessed using the Premature Infant Pain Profile (PIPP). A 3-point change in the pain score was considered clinically significant, leading to a sample size of 54 infants, with 90% statistical power. Local skin reactions and immediate adverse cardiorespiratory events were noted. The primary outcome, PIPP score at 1 minute, was analysed using an independent Student's t-test. RESULTS: Fifty-four infants were included, 27 +/- 2 weeks gestation, 916 +/- 292 grams and 6.5 +/- 3.2 days of age. Baseline characteristics were similar between groups. The mean PIPP score in the first minute was 10.88 in the treatment group as compared to 11.74 in the placebo group (difference 0.86, 95% CI -1.86, 3.58). Median duration of crying in non-intubated infants was 181 seconds in the tetracaine group compared to 68 seconds in the placebo group (difference -78, 95% CI -539, 117). Local skin erythema was observed transiently in 4 infants (3 in the treatment and 1 in the placebo group). No serious harms were observed. CONCLUSION: Tetracaine 4% when applied for 30 minutes was not beneficial in decreasing procedural pain associated with a PICC in very small infants. [Abstract/Link to Full Text]

Baier RJ, Loggins J, Yanamandra K
IL-10, IL-6 and CD14 polymorphisms and sepsis outcome in ventilated very low birth weight infants.
BMC Med. 2006;410.
BACKGROUND: Genetic variation in the innate immune system of the host may play a role in determining the risk of developing infection, as well as outcome from infection. METHODS: Infectious complications were retrospectively determined in 293 (233 African-American (AA), 57 Caucasian and 3 Hispanic) mechanically ventilated very low birth weight (VLBW) infants (<1500 grams at birth) who were genotyped for the IL-6 -174 G/C, IL-10 -1082 G/A and CD14 -260 C/T single nucleotide polymorphisms (SNPs). RESULTS: The IL-6 -174C allele was associated with an increased incidence of late blood stream infection (BSI) in AA but not Caucasian infants. In AA infants with the C allele the incidence of late BSI was 20/29 (69%) compared to 94/204 (46%) in homozygous GG infants (RR 2.6, 95% CI: 1.1-6.0, p = 0.021). The IL-10 -1082A allele was associated with an increased incidence of late BSI. One or more episodes of late BSI developed in 14 (35%) of 40 infants with the GG genotype, 71 (49%) of 145 infants with the GA genotype and 63 (58%) of 108 infants with the AA genotype (p = 0.036). Infants with the A allele (AA or GA genotypes) had an incidence of late BSI that was 134/253 (53%) compared to 14/40 (35%) in homozygous GG infants (RR 2.1, 95% CI: 1.04-4.19, p = 0.035). The CD14 -260 C/T SNP did not alter the overall risk for BSI in ventilated VLBW infants. Multiple BSI episodes were more common in the TT genotype group (CC: 17%, CT: 11%, TT: 30%, p = 0.022). This effect was due to the strong effect of the TT genotype on the incidence of multiple BSI in AA infants (CC: 15%, CT: 11%, TT: 39%, p = 0.003). CONCLUSION: The IL-6 -174 G/C, IL-10 -1082 G/A and CD14 -260 C/T SNPs may alter risk for BSI in ventilated VLBW infants. [Abstract/Link to Full Text]

Wearden AJ, Riste L, Dowrick C, Chew-Graham C, Bentall RP, Morriss RK, Peters S, Dunn G, Richardson G, Lovell K, Powell P
Fatigue Intervention by Nurses Evaluation--the FINE Trial. A randomised controlled trial of nurse led self-help treatment for patients in primary care with chronic fatigue syndrome: study protocol. [ISRCTN74156610].
BMC Med. 2006;49.
BACKGROUND: Chronic fatigue syndrome, also known as ME (CFS/ME), is a condition characterised primarily by severe, disabling fatigue, of unknown origin, which has a poor prognosis and serious personal and economic consequences. Evidence for the effectiveness of any treatment for CFS/ME in primary care, where most patients are seen, is sparse. Recently, a brief, pragmatic treatment for CFS/ME, based on a physiological dysregulation model of the condition, was shown to be successful in improving fatigue and physical functioning in patients in secondary care. The treatment involves providing patients with a readily understandable explanation of their symptoms, from which flows the rationale for a graded rehabilitative plan, developed collaboratively with the therapist. The present trial will test the effectiveness and cost-effectiveness of pragmatic rehabilitation when delivered by specially trained general nurses in primary care. We selected a client-centred counselling intervention, called supportive listening, as a comparison treatment. Counselling has been shown to be as effective as cognitive behaviour therapy for treating fatigue in primary care, is more readily available, and controls for supportive therapist contact time. Our control condition is treatment as usual by the general practitioner (GP). METHODS AND DESIGN: This study protocol describes the design of an ongoing, single-blind, pragmatic randomized controlled trial of a brief (18 week) self-help treatment, pragmatic rehabilitation, delivered by specially trained nurse-therapists in patients' homes, compared with nurse-therapist delivered supportive listening and treatment as usual by the GP. An economic evaluation, taking a societal viewpoint, is being carried out alongside the clinical trial. Three adult general nurses were trained over a six month period to deliver the two interventions. Patients aged over 18 and fulfilling the Oxford criteria for CFS are assessed at baseline, after the intervention, and again one year later. Primary outcomes are self-reported physical functioning and fatigue at one year, and will be analysed on an intention-to-treat basis. A qualitative study will examine the interventions' mechanisms of change, and also GPs' drivers and barriers towards referral. [Abstract/Link to Full Text]

Kari K, Liu W, Gautama K, Mammen MP, Clemens JD, Nisalak A, Subrata K, Kim HK, Xu ZY
A hospital-based surveillance for Japanese encephalitis in Bali, Indonesia.
BMC Med. 2006;48.
BACKGROUND: Japanese encephalitis (JE) is presumed to be endemic throughout Asia, yet only a few cases have been reported in tropical Asian countries such as Indonesia, Malaysia and the Philippines. To estimate the true disease burden due to JE in this region, we conducted a prospective, hospital-based surveillance with a catchment population of 599,120 children less than 12 years of age in Bali, Indonesia, from July 2001 through December 2003. METHODS: Balinese children presenting to any health care facility with acute viral encephalitis or aseptic meningitis were enrolled. A "confirmed" diagnosis of JE required the detection of JE virus (JEV)-specific IgM in cerebrospinal fluid, whereas a diagnosis of "probable JE" was assigned to those cases in which JEV-specific IgM was detected only in serum. RESULTS: In all, 86 confirmed and 4 probable JE cases were identified. The annualized JE incidence rate was 7.1 and adjusted to 8.2 per 100,000 for children less than 10 years of age over the 2.5 consecutive years of study. Only one JE case was found among 96,920 children 10-11 years old (0.4 per 100,000). Nine children (10%) died and 33 (37%) of the survivors had neurological sequelae at discharge. JEV was transmitted in Bali year-round with 70% of cases in the rainy season. CONCLUSION: JE incidence and case-fatality rates in Bali were comparable to those of other JE-endemic countries of Asia. Our findings contradict the common wisdom that JE is rare in tropical Asia. Hence, the geographical range of endemic JE is broader than previously described. The results of the study support the need to introduce JE vaccination into Bali. [Abstract/Link to Full Text]

Dandona L, Dandona R
What is the global burden of visual impairment?
BMC Med. 2006;46.
BACKGROUND: A recent estimate by the World Health Organization (WHO) suggests that 161 million persons worldwide have visual impairment, including 37 million blind (best-corrected visual acuity less than 3/60 in the better eye) and 124 million with visual impairment less severe than blindness (best-corrected acuity less than 6/18 to 3/60 in the better eye). This estimate is quoted widely, but because it is based on definitions using best-corrected visual acuity, uncorrected refractive error as a cause of visual impairment is excluded. METHODS: We reviewed data from population-based surveys of visual impairment worldwide published 1996 onwards that included presenting visual acuity, and estimated the proportion of visual impairment caused by uncorrected refractive error in different sub-regions of the world. We then extrapolated these data to estimate the worldwide burden of visual impairment including that caused by uncorrected refractive error. RESULTS: The total number of persons with visual impairment worldwide, including that due to uncorrected refractive error, was estimated as 259 million, 61% higher than the commonly quoted WHO estimate. This includes 42 million persons with blindness defined as presenting visual acuity less than 3/60 in the better eye, and 217 million persons with less severe visual impairment level defined as presenting visual acuity less than 6/18 to 3/60 in the better eye, 14% and 75% higher, respectively, than the WHO estimates based on best-corrected visual acuity. Sensitivity analysis, taking into account the uncertainty of the proportion of visual impairment caused by refractive error, revealed that the number of persons in the world with visual impairment due to uncorrected refractive error could range from 82 to 117 million. CONCLUSION: The actual burden of visual impairment worldwide, including that caused by uncorrected refractive error, is substantially higher than the commonly quoted WHO estimate that is based on best-corrected visual acuity. We suggest that the indicative estimate of 259 million persons with visual impairment worldwide, which includes 42 million blind with visual acuity less than 3/60 in the better eye, be used for further planning of the VISION 2020 initiative instead of the often quoted 161 million estimate that includes 37 million blind. [Abstract/Link to Full Text]

Dandona L, Dandona R
Revision of visual impairment definitions in the International Statistical Classification of Diseases.
BMC Med. 2006;47.
BACKGROUND: The existing definitions of visual impairment in the International Statistical Classification of Diseases are based on recommendations made over 30 years ago. New data and knowledge related to visual impairment that have accumulated over this period suggest that these definitions need to be revised. DISCUSSION: Three major issues need to be addressed in the revision of these definitions. First, the existing definitions are based on best-corrected visual acuity, which exclude uncorrected refractive error as a cause of visual impairment, leading to substantial underestimation of the total visual impairment burden by about 38%. Second, the cut-off level of visual impairment to define blindness in the International Statistical Classification of Diseases is visual acuity less than 3/60 in the better eye, but with increasing human development the visual acuity requirements are also increasing, suggesting that a level less than 6/60 be used to define blindness. Third, the International Statistical Classification of Diseases uses the term 'low vision' for visual impairment level less than blindness, which causes confusion with the common use of this term for uncorrectable vision requiring aids or rehabilitation, suggesting that alternative terms such as moderate and mild visual impairment would be more appropriate for visual impairment less severe than blindness. We propose a revision of the definitions of visual impairment in the International Statistical Classification of Diseases that addresses these three issues. According to these revised definitions, the number of blind persons in the world defined as presenting visual acuity less than 6/60 in the better eye would be about 57 million as compared with the World Health Organization estimate of 37 million using the existing International Statistical Classification of Diseases definition of best-corrected visual acuity less than 3/60 in the better eye, and the number of persons in the world with moderate visual impairment defined as presenting visual acuity less than 6/18 to 6/60 in the better eye would be about 202 million as compared with the World Health Organization estimate of 124 million persons with low vision defined as best-corrected visual acuity less than 6/18 to 3/60 in the better eye. CONCLUSION: Our suggested revision of the visual impairment definitions in the International Statistical Classification of Diseases takes into account advances in the understanding of visual impairment. This revised classification seems more appropriate for estimating and tracking visual impairment in the countries and regions of the world than the existing classification in the International Statistical Classification of Diseases. [Abstract/Link to Full Text]

Fensterle J, Trefzer U, Berger T, Andersen MH, Ugurel S, Becker JC
HLA-B8 association with late-stage melanoma--an immunological lesson?
BMC Med. 2006;45.
BACKGROUND: Differences in HLA allele frequencies between the diseased and healthy populations may signify efficient immune responses, a notion that has been successfully tested for infectious diseases or for association with genetic elements involved in a distinct type of immunity. This retrospective study is intended to detect differences in MHC class I carrier frequencies of advanced melanoma patients compared to healthy bone marrow donors. METHODS: The HLA-A and -B carrier frequencies of 748 stage IV melanoma patients retrieved from serotyping at 6 different centers in Germany were compared using a chi-square test to 13,386 fully HLA typed bone marrow donors registered in the German national bone marrow donor registry. RESULTS: The comparison of HLA carrier frequencies in advanced cancer patients with healthy bone marrow donors revealed a significant decrease in HLA-B8 carrier frequencies, which was also apparent in patients with advanced disease compared to patients with loco-regional disease. CONCLUSION: The data suggest that protective immune responses restricted to distinct MHC class I molecules may be operational in a subset of melanoma patients, which is the prerequisite for a large scale screen for the corresponding epitopes. Alternatively, the known association of the ancestral haplotype HLA-A1, -B8 and -DR3 with genetic elements such as distinct TNF-alpha alleles might have a protective effect on disease progression. In any case, identification of the cause of protection within this patient subset might lead to a significant improvement in the efficacy of current immunotherapeutic approaches. [Abstract/Link to Full Text]

Nabulsi MM, Tamim H, Mahfoud Z, Itani M, Sabra R, Chamseddine F, Mikati M
Alternating ibuprofen and acetaminophen in the treatment of febrile children: a pilot study [ISRCTN30487061].
BMC Med. 2006;44.
BACKGROUND: Alternating ibuprofen and acetaminophen for the treatment of febrile children is a prevalent practice among physicians and parents, despite the lack of evidence on effectiveness or safety. This randomized, double-blind and placebo-controlled clinical trial aims at comparing the antipyretic effectiveness and safety of a single administration of alternating ibuprofen and acetaminophen doses to that of ibuprofen mono-therapy in febrile children. METHODS: Seventy febrile children were randomly allocated to receive either a single oral dose of 10 mg/kg ibuprofen and 15 mg/kg oral acetaminophen after 4 hours, or a similar dose of ibuprofen and placebo at 4 hours. Rectal temperature was measured at baseline, 4, 5, 6, 7 and 8 hours later. Endpoints included proportions of afebrile children at 6, 7 and 8 hours, maximum decline in temperature, time to recurrence of fever, and change in temperature from baseline at each time point. Intent-to-treat analysis was planned with statistical significance set at P < 0.05. RESULTS: A higher proportion of subjects in the intervention group (83.3%) became afebrile at 6 hours than in the control group (57.6%); P = 0.018. This difference was accentuated at 7 and 8 hours (P < 0.001) with a significantly longer time to recurrence of fever in the intervention group (mean +/- SD of 7.4 +/- 1.3 versus 5.7 +/- 2.2 hours), P < 0.001. Odds ratios (95%CI) for defervescence were 5.6 (1.3; 23.8), 19.5 (3.5; 108.9) and 15.3 (3.4; 68.3) at 6, 7 and 8 hours respectively. Two-way ANOVA with repeated measures over time revealed a significantly larger decline in temperature in the intervention group at times 7 (P = 0.026) and 8 (P = 0.002) hours. CONCLUSION: A single dose of alternating ibuprofen and acetaminophen appears to be a superior antipyretic regimen than ibuprofen mono-therapy. Further studies are needed to confirm these findings. [Abstract/Link to Full Text]

Small R, Lumley J, Toomey L
Midwife-led debriefing after operative birth: four to six year follow-up of a randomised trial [ISRCTN24648614].
BMC Med. 2006;43.
BACKGROUND: There is little evidence that single-session debriefing is effective in reducing adverse mental health outcomes after trauma. Few trials have included long-term follow-up, but two also suggest possible negative effects of debriefing. We aimed to assess longer-term maternal health outcomes in a trial of midwife-led debriefing following an operative birth, given that findings at six months could not rule out a possible adverse effect of debriefing. METHODS: Four to six years after participating in a midwife-led trial of debriefing following an operative birth, 1039/1041 women were mailed a questionnaire containing the Edinburgh Postnatal Depression Scale (EPDS) and the SF-36 health status measure. RESULTS: Responses were obtained from 534 women (51.4%). Responders from the two trial groups remained comparable 4-6 years postpartum. No significant differences on maternal health outcomes were found between the trial groups. CONCLUSION: In the longer term, maternal health status was neither positively nor adversely affected by the experience of debriefing, despite a hint of adverse effects at six months postpartum. Short debriefing interventions have not proven effective in improving mental health outcomes for women following childbirth. [Abstract/Link to Full Text]

Roberts NJ, Partridge MR
How useful are post consultation letters to patients?
BMC Med. 2006;42.
BACKGROUND: As part of the NHS plan it was suggested that all patients receive copies of letters sent to their General Practitioner following outpatient consultations. The former Secretary of State for Health extended this proposal, suggesting that patients have a specific letter to themselves after a hospital consultation. METHODS: The aim of this study was to send cardiorespiratory patients attending Charing Cross Hospital, a copy of the letter sent to their G.P. plus a specific letter to themselves and to assess the usefulness and comprehensibility of each. The letters were analysed for dictation time, Flesch Reading Ease Score, Flesch-Kincaid Grade Level and word count. Eighty-four out of 105 sequential patients (80%) consented and were sent both types of letter after their attendance. Patients returned both letters circling any items they did not understand and stated a preference for the GP letter, patient letter, or both. The patients' GPs were subsequently also asked for their views on each letter. RESULTS: GP letters took significantly longer to dictate than patient letters. The Flesch Reading Ease Score was significantly higher in the patient letters, indicating that the patient letters were easier to read. The GP letters were significantly longer than the patient letters and patients were significantly more likely to circle more items in the GP letters (p < 0.001). The content of letters is sometimes inaccurate. Thirty-six out of 62 patients (58%) would like to receive both letters, 13/62 (21.6%) would prefer the GP letter and 13/62 (20%) wanted only the patient letter. 45 GPs replied (62.5%), 28/45 (62.5%) wanted the GP letter, 14 GPs (31.1%) wanted both letters and 3/45 (6.7%) wanted the patient letter only. General themes concerned insufficient clinical details and the GPs preferred the structure of the letters written to them. CONCLUSION: Patients appreciate copies of the letter being sent to their GP but comprehension is less good than with a shorter letter written especially to the patient. More attention needs to be paid to making letters to GPs simpler to read without losing the structure and detail liked by GPs. A compromise might be to dictate the letter in front of the patient and to provide a speciality-specific glossary to accompany each letter. [Abstract/Link to Full Text]

Trivedi MA, Schmitz TW, Ries ML, Torgerson BM, Sager MA, Hermann BP, Asthana S, Johnson SC
Reduced hippocampal activation during episodic encoding in middle-aged individuals at genetic risk of Alzheimer's disease: a cross-sectional study.
BMC Med. 2006;41.
BACKGROUND: The presence of the apolipoprotein E (APOE) epsilon4 allele is a major risk factor for the development of Alzheimer's disease (AD), and has been associated with metabolic brain changes several years before the onset of typical AD symptoms. Functional MRI (fMRI) is a brain imaging technique that has been used to demonstrate hippocampal activation during measurement of episodic encoding, but the effect of the epsilon4 allele on hippocampal activation has not been firmly established. METHODS: The present study examined the effects of APOE genotype on brain activation patterns in the medial temporal lobe (MTL) during an episodic encoding task using a well-characterized novel item versus familiar item contrast in cognitively normal, middle-aged (mean = 54 years) individuals who had at least one parent with AD. RESULTS: We found that epsilon3/4 heterozygotes displayed reduced activation in the hippocampus and MTL compared to epsilon3/3 homozygotes. There were no significant differences between the groups in age, education or neuropsychological functioning, suggesting that the altered brain activation seen in epsilon3/4 heterozygotes was not associated with impaired cognitive function. We also found that participants' ability to encode information on a neuropsychological measure of learning was associated with greater activation in the anterior MTL in the epsilon3/3 homozygotes, but not in the epsilon3/4 heterozygotes. CONCLUSION: Together with previous studies reporting reduced glucose metabolism and AD-related neuropathology, this study provides convergent validity for the idea that the MTL exhibits functional decline associated with the APOE epsilon4 allele. Importantly, these changes were detected in the absence of meaningful neuropsychological differences between the groups. A focus of ongoing work in this laboratory is to determine if these findings are predictive of subsequent cognitive decline. [Abstract/Link to Full Text]

Liu-Seifert H, Adams DH, Kinon BJ
Discontinuation of treatment of schizophrenic patients is driven by poor symptom response: a pooled post-hoc analysis of four atypical antipsychotic drugs.
BMC Med. 2005;321.
BACKGROUND: Stopping antipsychotic treatment can interrupt improvement and exacerbate the illness. The reasons for discontinuing treatment during controlled clinical trials were analyzed to explore this phenomenon. METHODS: A post-hoc, pooled analysis was made of 4 randomized, double-blind clinical trials, 24-28 weeks in duration, involving 1627 patients with schizophrenia or a related disorder. Analyses combined all the atypical antipsychotic treatment groups in the studies. RESULTS: The majority of patients (53%) stopped their treatment at an early stage. Poor psychiatric response along with worsening symptoms was the most frequently given reason for discontinuing the course (36%), which was substantially more common than discontinuation due to poor tolerability of the medication (12%). This phenomenon was corroborated by less improvement in patients who discontinued treatment compared with those who completed, based on the PANSS total scores. Discontinuation due to poor response was, apparently, more predominantly linked to patient perception than to physicians' conclusions alone (80% vs. 20%). Discontinuation due to patient perception of poor response appeared to occur particularly early in the course of treatment. Patients who discontinued due to poor toleration of the medication responded in a more comparable manner with completers. CONCLUSION: Discontinuing treatment may lead to exacerbation of symptoms, undermining therapeutic progress. In these studies, poor response to treatment and worsening of underlying psychiatric symptoms, and to a lesser extent, intolerability to medication were the primary contributors to treatment being discontinued. Our findings suggest that adherence may be enhanced by effective symptom control, as objectively measured and as subjectively perceived. Such strategies may improve patients' willingness to undertake long-term therapy and increase the likelihood of a better prognosis. [Abstract/Link to Full Text]

Fleisher DR, Gornowicz B, Adams K, Burch R, Feldman EJ
Cyclic Vomiting Syndrome in 41 adults: the illness, the patients, and problems of management.
BMC Med. 2005;320.
BACKGROUND: Cyclic Vomiting Syndrome (CVS) is a disorder characterized by recurrent, stereotypic episodes of incapacitating nausea, vomiting and other symptoms, separated by intervals of comparative wellness. This report describes the clinical features, co-morbidities and problems encountered in management of 41 adult patients who met the diagnostic criteria for CVS. METHODS: This is a retrospective study of adults with CVS seen between 1994 and 2003. Follow-up data were obtained by mailed questionnaires. RESULTS: Age of onset ranged from 2 to 49 years. The duration of CVS at the time of consultation ranged from less than 1 year to 49 years. CVS episodes were stereotypic in respect of their hours of onset, symptomatology and length. Ninety-three percent of patients had recognizable prodromes. Half of the patients experienced a constellation of symptoms consisting of CVS episodes, migraine diathesis, inter-episodic dyspeptic nausea and a history of panic attacks. Deterioration in the course of CVS is indicated by coalescence of episodes in time. The prognosis of CVS is favorable in the majority of patients. CONCLUSION: CVS is a disabling disorder affecting adults as well as children. Because its occurrence in adults is little known, patients experience delayed or mis-diagnosis and ineffectual, sometimes inappropriately invasive management. [Abstract/Link to Full Text]

Reeves WC, Wagner D, Nisenbaum R, Jones JF, Gurbaxani B, Solomon L, Papanicolaou DA, Unger ER, Vernon SD, Heim C
Chronic fatigue syndrome--a clinically empirical approach to its definition and study.
BMC Med. 2005;319.
BACKGROUND: The lack of standardized criteria for defining chronic fatigue syndrome (CFS) has constrained research. The objective of this study was to apply the 1994 CFS criteria by standardized reproducible criteria. METHODS: This population-based case control study enrolled 227 adults identified from the population of Wichita with: (1) CFS (n = 58); (2) non-fatigued controls matched to CFS on sex, race, age and body mass index (n = 55); (3) persons with medically unexplained fatigue not CFS, which we term ISF (n = 59); (4) CFS accompanied by melancholic depression (n = 27); and (5) ISF plus melancholic depression (n = 28). Participants were admitted to a hospital for two days and underwent medical history and physical examination, the Diagnostic Interview Schedule, and laboratory testing to identify medical and psychiatric conditions exclusionary for CFS. Illness classification at the time of the clinical study utilized two algorithms: (1) the same criteria as in the surveillance study; (2) a standardized clinically empirical algorithm based on quantitative assessment of the major domains of CFS (impairment, fatigue, and accompanying symptoms). RESULTS: One hundred and sixty-four participants had no exclusionary conditions at the time of this study. Clinically empirical classification identified 43 subjects as CFS, 57 as ISF, and 64 as not ill. There was minimal association between the empirical classification and classification by the surveillance criteria. Subjects empirically classified as CFS had significantly worse impairment (evaluated by the SF-36), more severe fatigue (documented by the multidimensional fatigue inventory), more frequent and severe accompanying symptoms than those with ISF, who in turn had significantly worse scores than the not ill; this was not true for classification by the surveillance algorithm. CONCLUSION: The empirical definition includes all aspects of CFS specified in the 1994 case definition and identifies persons with CFS in a precise manner that can be readily reproduced by both investigators and clinicians. [Abstract/Link to Full Text]

Broen AN, Moum T, B�dtker AS, Ekeberg O
The course of mental health after miscarriage and induced abortion: a longitudinal, five-year follow-up study.
BMC Med. 2005;318.
BACKGROUND: Miscarriage and induced abortion are life events that can potentially cause mental distress. The objective of this study was to determine whether there are differences in the patterns of normalization of mental health scores after these two pregnancy termination events. METHODS: Forty women who experienced miscarriages and 80 women who underwent abortions at the main hospital of Buskerud County in Norway were interviewed. All subjects completed the following questionnaires 10 days (T1), six months (T2), two years (T3) and five years (T4) after the pregnancy termination: Impact of Event Scale (IES), Quality of Life, Hospital Anxiety and Depression Scale (HADS), and another addressing their feelings about the pregnancy termination. Differential changes in mean scores were determined by analysis of covariance (ANCOVA) and inter-group differences were assessed by ordinary least squares methods. RESULTS: Women who had experienced a miscarriage had more mental distress at 10 days and six months after the pregnancy termination than women who had undergone an abortion. However, women who had had a miscarriage exhibited significantly quicker improvement on IES scores for avoidance, grief, loss, guilt and anger throughout the observation period. Women who experienced induced abortion had significantly greater IES scores for avoidance and for the feelings of guilt, shame and relief than the miscarriage group at two and five years after the pregnancy termination (IES avoidance means: 3.2 vs 9.3 at T3, respectively, p < 0.001; 1.5 vs 8.3 at T4, respectively, p < 0.001). Compared with the general population, women who had undergone induced abortion had significantly higher HADS anxiety scores at all four interviews (p < 0.01 to p < 0.001), while women who had had a miscarriage had significantly higher anxiety scores only at T1 (p < 0.01). CONCLUSION: The course of psychological responses to miscarriage and abortion differed during the five-year period after the event. Women who had undergone an abortion exhibited higher scores during the follow-up period for some outcomes. The difference in the courses of responses may partly result from the different characteristics of the two pregnancy termination events. [Abstract/Link to Full Text]

Garc�a Rodr�guez LA, Gonz�lez-P�rez A
Long-term use of non-steroidal anti-inflammatory drugs and the risk of myocardial infarction in the general population.
BMC Med. 2005;317.
BACKGROUND: Recent data indicate that chronic use of coxibs leads to an increased occurrence of thrombotic cardiovascular events. This raises the question as to whether traditional non-steroidal anti-inflammatory drugs (tNSAIDs) might also produce similar hazards. Our aim has been to evaluate the association between the chronic use of tNSAIDs and the risk of myocardial infarction (MI) in patients. METHODS: We performed a nested case-control analysis with 4,975 cases of acute MI and 20,000 controls, frequency matched to cases by age, sex, and calendar year. RESULTS: Overall, current use of tNSAID was not associated with an increased risk of MI (RR:1.07;95%CI: 0.95-1.21). However, we found that the relative risk (RR) of MI for durations of tNSAID treatment of >1 year was 1.21 (95% CI, 1.00-1.48). The corresponding RR was 1.34 (95% CI, 1.06-1.70) for non-fatal MI. The effect was independent from dose. The small risk associated with long-term use of tNSAIDs was observed among patients not taking low-dose aspirin (RR: 1.29; 95% CI, 1.01-1.65). The effect of long-term use for individual tNSAIDs ranged from a RR of 0.87 (95% CI, 0.47-1.62) with naproxen to 1.38 (95% CI, 1.00-1.90) with diclofenac. CONCLUSION: This study adds support to the hypothesis that chronic treatment with some tNSAIDs is associated with a small increased risk of non-fatal MI. Our data are consistent with a substantial variability in cardiovascular risks between individual tNSAIDs. [Abstract/Link to Full Text]

Hem E, Stokke G, Tyssen R, Gr�nvold NT, Vaglum P, Ekeberg �
Self-prescribing among young Norwegian doctors: a nine-year follow-up study of a nationwide sample.
BMC Med. 2005;316.
BACKGROUND: Self-prescribing among doctors is common, but no longitudinal studies have documented this issue. We studied the self-prescribing behaviour among young Norwegian physicians and the predictors of self-prescribing. METHODS: We conducted a nationwide, prospective and longitudinal study following young Norwegian physicians from internship through the subsequent nine years using three postal questionnaires. Chi-square tests and logistic regression models were applied. RESULTS: About 54% of the physicians in their fourth and ninth postgraduate years had self-prescribed medication at least once during the previous year. Among those who had used prescription medication during the previous year, about 90% had self-prescribed. Self-prescribing behaviour did not differ significantly between men and women, or according to the type of work at any time. The most frequently self-prescribed medications were antibiotics (71%-81%), contraceptives (24%-25%), analgesics (18%-21%), and hypnotics (9%-12%). Those who had needed treatment for mental problems had self-prescribed hypnotics and sedatives to a greater extent than the others. Being male, having self-prescribed during internship, somatic complaints, mental distress, subjective health complaints, and not having sought help from a general practitioner, were significant adjusted predictors of self-prescribing in the ninth postgraduate year. CONCLUSION: The level of self-prescribing among young Norwegian physicians is relatively high, and this behaviour is established early in their professional lives. Although self-prescribing is acceptable in some situations, physicians should seek professional help for illness. Efforts to inculcate more rational help-seeking behaviour should probably start in medical schools. [Abstract/Link to Full Text]

Adams CE, Rathbone J, Thornley B, Clarke M, Borrill J, Wahlbeck K, Awad AG
Chlorpromazine for schizophrenia: a Cochrane systematic review of 50 years of randomised controlled trials.
BMC Med. 2005;315.
BACKGROUND: Chlorpromazine (CPZ) remains one of the most common drugs used for people with schizophrenia worldwide, and a benchmark against which other treatments can be evaluated. Quantitative reviews are rare; this one evaluates the effects of chlorpromazine in the treatment of schizophrenia in comparison with placebo. METHODS: We sought all relevant randomised controlled trials (RCT) comparing chlorpromazine to placebo by electronic and reference searching, and by contacting trial authors and the pharmaceutical industry. Data were extracted from selected trials and, where possible, synthesised and random effects relative risk (RR), the number needed to treat (NNT) and their 95% confidence intervals (CI) calculated. RESULTS: Fifty RCTs from 1955-2000 were included with 5276 people randomised to CPZ or placebo. They constitute 2008 person-years spent in trials. Meta-analysis of these trials showed that chlorpromazine promotes a global improvement (n = 1121, 13 RCTs, RR 0.76 CI 0.7 to 0.9, NNT 7 CI 5 to 10), although a considerable placebo response is also seen. People allocated to chlorpromazine tended not to leave trials early in both the short (n = 945, 16 RCTs, RR 0.74 CI 0.5 to 1.1) and medium term (n = 1861, 25 RCTs, RR 0.79 CI 0.6 to 1.1). There were, however, many adverse effects. Chlorpromazine is sedating (n = 1242, 18 RCTs, RR 2.3 CI 1.7 to 3.1, NNH 6 CI 5 to 8), increases a person's chances of experiencing acute movement disorders, Parkinsonism and causes low blood pressure with dizziness and dry mouth. CONCLUSION: It is understandable why the World Health Organization (WHO) have endorsed and included chlorpromazine in their list of essential drugs for use in schizophrenia. Low- and middle-income countries may have more complete evidence upon which to base their practice compared with richer nations using recent innovations. [Abstract/Link to Full Text]

Aursnes I, Tvete IF, Gaasemyr J, Natvig B
Suicide attempts in clinical trials with paroxetine randomised against placebo.
BMC Med. 2005;314.
BACKGROUND: Inclusion of unpublished data on the effects of antidepressants on children has suggested unfavourable risk-benefit profiles for some of the drugs. Recent meta-analyses of studies on adults have indicated similar effects. We obtained unpublished data for paroxetine that have so far not been included in these analyses. METHODS: The documentation for drug registration contained 16 studies in which paroxetine had been randomised against placebo. We registered the number of suicides, suicide attempts and ideation. We corrected for duration of medication and placebo treatment and used a standard Bayesian statistical approach with varying priors. RESULTS: There were 7 suicide attempts in patients on the drug and 1 in a patient on placebo. We found that the probability of increased intensity of suicide attempts per year in adults taking paroxetine was 0.90 with a "pessimistic" prior, and somewhat less with two more neutral priors. CONCLUSION: Our findings support the results of recent meta-analyses. Patients and doctors should be warned that the increased suicidal activity observed in children and adolescents taking certain antidepressant drugs may also be present in adults. [Abstract/Link to Full Text]

McManus IC, Mollon J, Duke OL, Vale JA
Changes in standard of candidates taking the MRCP(UK) Part 1 examination, 1985 to 2002: analysis of marker questions.
BMC Med. 2005;313.
BACKGROUND: The maintenance of standards is a problem for postgraduate medical examinations, particularly if they use norm-referencing as the sole method of standard setting. In each of its diets, the MRCP(UK) Part 1 Examination includes a number of marker questions, which are unchanged from their use in a previous diet. This paper describes two complementary studies of marker questions for 52 diets of the MRCP(UK) Part 1 Examination over the years 1985 to 2001 to assess whether standards have changed. METHODS: Study 1, which used routinely collected information on the performance of 4405 marker items, used a statistical method to assess changes in performance across diets. Study 2 compared performances of individual candidates on 28 individual marker items that were shared by the 1996/2 and 2001/3 diets. RESULTS: Study 1 found evidence that candidate performance on the MRCP(UK) Part 1 Examination showed a gradual improvement over the period 1985 to 1997, which was followed by a sharp decline in performance until 2001. The 'dog-leg' in performance at 1997/3 was not an artefact of changed Examination Regulations, mix of UK and overseas candidates, or time from qualification until taking the Examination. Study 2 confirmed that performance in 2001/3 was significantly worse than in 1996/3, that the poorer performance was found in graduates of UK medical schools, and that candidates passing the Examination in 2001/3 performed less well than those passing in 1996/2. CONCLUSION: There has been a decline in the performance of graduates from UK medical schools taking the MRCP(UK) Part 1 examination. The reasons for this are not clear, but the finding has implications for medical education, and further studies are needed of performance in other postgraduate and undergraduate examinations. The use of norm-referencing as the sole method for setting the pass mark over this period meant that candidates passing the MRCP(UK) examination also had a lower standard. The MRCP(UK) Part 1 and Part 2 examinations now have their standard set by criterion-referencing. [Abstract/Link to Full Text]

Jorm AF, Nakane Y, Christensen H, Yoshioka K, Griffiths KM, Wata Y
Public beliefs about treatment and outcome of mental disorders: a comparison of Australia and Japan.
BMC Med. 2005;312.
BACKGROUND: Surveys of the public in a number of countries have shown poor recognition of mental disorders and beliefs about treatment that often diverge from those of health professionals. This lack of mental health literacy can limit the optimal use of treatment services. Australia and Japan are countries with very different mental health care systems, with Japan emphasising hospital care and Australia more oriented to community care. Japan is also more collectivist and Australia more individualist in values. These differences might influence recognition of disorders and beliefs about treatment in the two countries. METHODS: Surveys of the public were carried out in each country using as similar a methodology as feasible. In both countries, household interviews were carried out concerning beliefs in relation to one of four case vignettes, describing either depression, depression with suicidal thoughts, early schizophrenia or chronic schizophrenia. In Australia, the survey involved a national sample of 3998 adults aged 18 years or over. In Japan, the survey involved 2000 adults aged between 20 and 69 from 25 regional sites spread across the country. RESULTS: The Japanese public were found to be more reluctant to use psychiatric labels, particularly for the depression cases. The Japanese were also more reluctant to discuss mental disorders with others outside the family. They had a strong belief in counsellors, but not in GPs. They generally believe in the benefits of treatment, but are not optimistic about full recovery. By contrast, Australians used psychiatric labels more often, particularly "depression". They were also more positive about the benefits of seeking professional help, but had a strong preference for lifestyle interventions and tended to be negative about some psychiatric medications. Australians were positive about both counsellors and GPs. Psychiatric hospitalization and ECT were seen negatively in both countries. CONCLUSION: There are some major differences between Australia and Japan in recognition of disorders and beliefs about treatment. Some of these may relate to the different health care systems, but the increasing openness about mental health in Australia is also likely to be an explanatory factor. [Abstract/Link to Full Text]

Diau GY, Hsieh AT, Sarkadi-Nagy EA, Wijendran V, Nathanielsz PW, Brenna JT
The influence of long chain polyunsaturate supplementation on docosahexaenoic acid and arachidonic acid in baboon neonate central nervous system.
BMC Med. 2005;311.
BACKGROUND: Docosahexaenoic acid (DHA) and arachidonic acid (ARA) are major components of the cerebral cortex and visual system, where they play a critical role in neural development. We quantitatively mapped fatty acids in 26 regions of the four-week-old breastfed baboon CNS, and studied the influence of dietary DHA and ARA supplementation and prematurity on CNS DHA and ARA concentrations. METHODS: Baboons were randomized into a breastfed (B) and four formula-fed groups: term, no DHA/ARA (T-); term, DHA/ARA supplemented (T+); preterm, no DHA/ARA (P-); preterm and DHA/ARA supplemented (P+). At four weeks adjusted age, brains were dissected and total fatty acids analyzed by gas chromatography and mass spectrometry. RESULTS: DHA and ARA are rich in many more structures than previously reported. They are most concentrated in structures local to the brain stem and diencephalon, particularly the basal ganglia, limbic regions, thalamus and midbrain, and comparatively lower in white matter. Dietary supplementation increased DHA in all structures but had little influence on ARA concentrations. Supplementation restored DHA concentrations to levels of breastfed neonates in all regions except the cerebral cortex and cerebellum. Prematurity per se did not exert a strong influence on DHA or ARA concentrations. CONCLUSION: 1) DHA and ARA are found in high concentration throughout the primate CNS, particularly in gray matter such as basal ganglia; 2) DHA concentrations drop across most CNS structures in neonates consuming formulas with no DHA, but ARA levels are relatively immune to ARA in the diet; 3) supplementation of infant formula is effective at restoring DHA concentration in structures other than the cerebral cortex. These results will be useful as a guide to future investigations of CNS function in the absence of dietary DHA and ARA. [Abstract/Link to Full Text]

Kim JY, Siegmund KD, Tavar� S, Shibata D
Age-related human small intestine methylation: evidence for stem cell niches.
BMC Med. 2005;310.
BACKGROUND: The small intestine is constructed of many crypts and villi, and mouse studies suggest that each crypt contains multiple stem cells. Very little is known about human small intestines because mouse fate mapping strategies are impractical in humans. However, it is theoretically possible that stem cell histories are inherently written within their genomes. Genomes appear to record histories (as exemplified by use of molecular clocks), and therefore it may be possible to reconstruct somatic cell dynamics from somatic cell errors. Recent human colon studies suggest that random somatic epigenetic errors record stem cell histories (ancestry and total numbers of divisions). Potentially age-related methylation also occurs in human small intestines, which would allow characterization of their stem cells and comparisons with the colon. METHODS: Methylation patterns in individual crypts from 13 small intestines (17 to 78 years old) were measured by bisulfite sequencing. The methylation patterns were analyzed by a quantitative model to distinguish between immortal or niche stem cell lineages. RESULTS: Age-related methylation was observed in the human small intestines. Crypt methylation patterns were more consistent with stem cell niches than immortal stem cell lineages. Human large and small intestine crypt niches appeared to have similar stem cell dynamics, but relatively less methylation accumulated with age in the small intestines. There were no apparent stem cell differences between the duodenum and ileum, and stem cell survival did not appear to decline with aging. CONCLUSION: Crypt niches containing multiple stem cells appear to maintain human small intestines. Crypt niches appear similar in the colon and small intestine, and the small intestinal stem cell mitotic rate is the same as or perhaps slower than that of the colon. Although further studies are needed, age-related methylation appears to record somatic cell histories, and a somatic epigenetic molecular clock strategy may potentially be applied to other human tissues to reconstruct otherwise occult stem cell histories. [Abstract/Link to Full Text]

van der Horst IC, Ottervanger JP, van 't Hof AW, Reiffers S, Miedema K, Hoorntje JC, Dambrink JH, Gosselink AT, Nijsten MW, Suryapranata H, de Boer MJ, Zijlstra F
The impact of glucose-insulin-potassium infusion in acute myocardial infarction on infarct size and left ventricular ejection fraction [ISRCTN56720616].
BMC Med. 2005;39.
BACKGROUND: Favorable clinical outcomes have been observed with glucose-insulin-potassium infusion (GIK) in acute myocardial infarction (MI). The mechanisms of this beneficial effect have not been delineated clearly. GIK has metabolic, anti-inflammatory and profibrinolytic effects and it may preserve the ischemic myocardium. We sought to assess the effect of GIK infusion on infarct size and left ventricular function, as part of a randomized controlled trial. METHODS: Patients (n = 940) treated for acute MI by primary percutaneous coronary intervention (PCI) were randomized to GIK infusion or no infusion. Endpoints were the creatinine kinase MB-fraction (CK-MB) and left ventricular ejection fraction (LVEF). CK-MB levels were determined 0, 2, 4, 6, 24, 48, 72 and 96 hours after admission and the LVEF was measured before discharge. RESULTS: There were no differences between the two groups in the time course or magnitude of CK-MB release: the peak CK-MB level was 249 +/- 228 U/L in the GIK group and 240 +/- 200 U/L in the control group (NS). The mean LVEF was 43.7 +/- 11.0 % in the GIK group and 42.4 +/- 11.7% in the control group (P = 0.12). A LVEF < or = 30% was observed in 18% in the controls and in 12% of the GIK group (P = 0.01). CONCLUSION: Treatment with GIK has no effect on myocardial function as determined by LVEF and by the pattern or magnitude of enzyme release. However, left ventricular function was preserved in GIK treated patients. [Abstract/Link to Full Text]

Alander T, Sv�rdsudd K, Johansson SE, Agr�us L
Psychological illness is commonly associated with functional gastrointestinal disorders and is important to consider during patient consultation: a population-based study.
BMC Med. 2005;38.
BACKGROUND: Some individuals with functional gastrointestinal disorders (FGID) suffer long-lasting symptoms without ever consulting their doctors. Our aim was to study co-morbidity and lifestyle differences among consulters and non-consulters with persistent FGID and controls in a defined adult population. METHODS: A random sample of the general adult Swedish population was obtained by a postal questionnaire. The Abdominal Symptom Questionnaire (ASQ) was used to measure GI symptomatology and grade of GI symptom severity and the Complaint Score Questionnaire (CSQ) was used to measure general symptoms. Subjects were then grouped for study by their symptomatic profiles. Subjects with long-standing FGID (n = 141) and subjects strictly free from gastrointestinal (GI) symptoms (n = 97) were invited to attend their local health centers for further assessment. RESULTS: Subjects with FGID have a higher risk of psychological illness [OR 8.4, CI95(4.0-17.5)] than somatic illness [OR 2.8, CI95(1.3-5.7)] or ache and fatigue symptoms [OR 4.3, CI95(2.1-8.7)]. Subjects with psychological illness have a higher risk of severe GI symptoms than controls; moreover they have a greater chance of being consulters. Patients with FGID have more severe GI symptoms than non-patients. CONCLUSION: There is a strong relation between extra-intestinal, mental and somatic complaints and FGID in both patients and non-patients. Psychological illness increases the chance of concomitantly having more severe GI symptoms, which also enhance consultation behaviour. [Abstract/Link to Full Text]

Wilczynski NL, Haynes RB
EMBASE search strategies for identifying methodologically sound diagnostic studies for use by clinicians and researchers.
BMC Med. 2005;37.
BACKGROUND: Accurate diagnosis by clinicians is the cornerstone of decision making for recommending clinical interventions. The current best evidence from research concerning diagnostic tests changes unpredictably as science advances. Both clinicians and researchers need dependable access to published evidence concerning diagnostic accuracy. Bibliographic databases such as EMBASE provide the most widely available entr�e to this literature. The objective of this study was to develop search strategies that optimize the retrieval of methodologically sound diagnostic studies from EMBASE for use by clinicians. METHODS: An analytic survey was conducted, comparing hand searches of 55 journals with retrievals from EMBASE for 4,843 candidate search terms and 6,574 combinations. All articles were rated using purpose and quality indicators, and clinically relevant diagnostic accuracy articles were categorized as 'pass' or 'fail' according to explicit criteria for scientific merit. Candidate search strategies were run in EMBASE, the retrievals being compared with the hand search data. The proposed search strategies were treated as "diagnostic tests" for sound studies and the manual review of the literature was treated as the "gold standard." The sensitivity, specificity, precision and accuracy of the search strategies were calculated. RESULTS: Of the 433 articles about diagnostic tests, 97 (22.4%) met basic criteria for scientific merit. Combinations of search terms reached peak sensitivities of 100% with specificity at 70.4%. Compared with best single terms, best multiple terms increased sensitivity for sound studies by 8.2% (absolute increase), but decreased specificity (absolute decrease 6%) when sensitivity was maximized. When terms were combined to maximize specificity, the single term "specificity.tw." (specificity of 98.2%) outperformed combinations of terms. CONCLUSION: Empirically derived search strategies combining indexing terms and textwords can achieve high sensitivity and specificity for retrieving sound diagnostic studies from EMBASE. These search filters will enhance the searching efforts of clinicians. [Abstract/Link to Full Text]

The effects of cholesterol lowering with simvastatin on cause-specific mortality and on cancer incidence in 20,536 high-risk people: a randomised placebo-controlled trial [ISRCTN48489393].
BMC Med. 2005;36.
BACKGROUND: There have been concerns that low blood cholesterol concentrations may cause non-vascular mortality and morbidity. Randomisation of large numbers of people to receive a large, and prolonged, reduction in cholesterol concentrations provides an opportunity to address such concerns reliably. METHODS: 20,536 UK adults (aged 40-80 years) with vascular disease or diabetes were randomly allocated to receive 40 mg simvastatin daily or matching placebo. Prespecified safety analyses were of cause-specific mortality, and of total and site-specific cancer incidence. Comparisons between all simvastatin-allocated versus all placebo-allocated participants (ie, "intention-to-treat") involved an average difference in blood total cholesterol concentration of 1.2 mmol/L (46 mg/dL) during the scheduled 5-year treatment period. RESULTS: There was a highly significant 17% (95% CI 9-25) proportional reduction in vascular deaths, along with a non-significant reduction in all non-vascular deaths, which translated into a significant reduction in all-cause mortality (p = 0.0003). The proportional reduction in the vascular mortality rate was about one-sixth in each subcategory of participant studied, including: men and women; under and over 70 years at entry; and total cholesterol below 5.0 mmol/L or LDL cholesterol below 3.0 mmol/L. No significant excess of non-vascular mortality was observed in any subcategory of participant (including the elderly and those with pretreatment total cholesterol below 5.0 mmol/L), and there was no significant excess in any particular cause of non-vascular mortality. Cancer incidence rates were similar in the two groups, both overall and in particular subcategories of participant, as well as at particular primary sites. There was no suggestion that any adverse trends in non-vascular mortality or morbidity were beginning to emerge with more prolonged treatment. CONCLUSION: These findings, which are based on large numbers of deaths and non-fatal cancers, provide considerable reassurance that lowering total cholesterol concentrations by more than 1 mmol/L for an average of 5 years does not produce adverse effects on non-vascular mortality or cancer incidence. Moreover, among the many different types of high-risk individual studied, simvastatin 40 mg daily consistently produced substantial reductions in vascular (and, hence, all-cause) mortality, as well as in the rates of non-fatal heart attacks, strokes and revascularisation procedures. [Abstract/Link to Full Text]

Recent Articles in BMC Complementary and Alternative Medicine

Gardiner P, Woods C, Kemper KJ
Dietary supplement use among health care professionals enrolled in an online curriculum on herbs and dietary supplements.
BMC Complement Altern Med. 2006;621.
BACKGROUND: Although many health care professionals (HCPs) in the United States have been educated about and recommend dietary supplements, little is known about their personal use of dietary supplements and factors associated with their use. METHODS: We surveyed HCPs at the point of their enrollment in an on-line course about dietary supplements between September, 2004 and May, 2005. We used multivariable logistic regression to analyze demographic and practice factors associated with use of dietary supplements. RESULTS: Of the 1249 health care professionals surveyed, 81 % reported having used a vitamin, mineral, or other non-herbal dietary supplements in the last week. Use varied by profession with highest rates among nurses (88%), physician assistants or nurse practitioners (84 %) and the lowest rates among pharmacists (66%) and trainees (72%). The most frequently used supplements were multivitamins (60%), calcium (40%), vitamin B (31%), vitamin C (30%), and fish oil (24%). Factors associated with higher supplement use were older age, female, high knowledge of dietary supplements, and discussing dietary supplements with patients. In our adjusted model, nurses were more likely than other professionals to use a multivitamin and students were more likely to use calcium. CONCLUSION: Among HCPs enrolled in an on-line course about dietary supplements, women, older clinicians, those with higher knowledge and those who talk with patients about dietary supplements had higher use of dietary supplements. Additional research is necessary to understand the impact of professionals' personal use of dietary supplements on communication with patients about them. [Abstract/Link to Full Text]

Dahlin L, Lund I, Lundeberg T, Molander C
Vibratory stimulation increase the electro-cutaneous sensory detection and pain thresholds in women but not in men.
BMC Complement Altern Med. 2006;620.
BACKGROUND: Vibratory stimulation is a potential method for the treatment of pain. METHODS: The effect of vibration on the forearm on detection (DT) and pain thresholds (PT) induced by electro-cutaneous stimulation were investigated in healthy male and female volunteers. RESULTS: Women have lower baseline detection and pain thresholds as compared to men. Furthermore, women but not men report increased detection and pain thresholds after vibratory stimulation. CONCLUSION: Our findings indicate the potential usefulness of vibratory stimulation for pain treatment, and that gender differences should be considered in future evaluation of the method. [Abstract/Link to Full Text]

Joos S, Rosemann T, Szecsenyi J, Hahn EG, Willich SN, Brinkhaus B
Use of complementary and alternative medicine in Germany - a survey of patients with inflammatory bowel disease.
BMC Complement Altern Med. 2006;619.
BACKGROUND: Previous studies have suggested an increasing use of complementary and alternative medicine (CAM) in patients with inflammatory bowel disease (IBD). The aim of our study was to evaluate the use of CAM in German patients with IBD. METHODS: A questionnaire was offered to IBD patients participating in patient workshops which were organized by a self-help association, the German Crohn's and Colitis Association. The self-administered questionnaire included demographic and disease-related data as well as items analysing the extent of CAM use and satisfaction with CAM treatment. Seven commonly used CAM methods were predetermined on the questionnaire. RESULTS: 413 questionnaires were completed and included in the analysis (n = 153 male, n = 260 female; n = 246 Crohn's disease, n = 164 ulcerative colitis). 52 % of the patients reported CAM use in the present or past. In detail, homeopathy (55%), probiotics (43%), classical naturopathy (38%), Boswellia serrata extracts (36%) and acupuncture/Traditional Chinese Medicine (TCM) (33%) were the most frequently used CAM methods. Patients using probiotics, acupuncture and Boswellia serrata extracts (incense) reported more positive therapeutic effects than others. Within the statistical analysis no significant predictors for CAM use were found. 77% of the patients felt insufficiently informed about CAM. CONCLUSION: The use of CAM in IBD patients is very common in Germany, although a large proportion of patients felt that information about CAM is not sufficient. However, to provide an evidence-based approach more research in this field is desperately needed. Therefore, physicians should increasingly inform IBD patients about benefits and limitations of CAM treatment. [Abstract/Link to Full Text]

Moss K, Boon H, Ballantyne P, Kachan N
New Canadian natural health product regulations: a qualitative study of how CAM practitioners perceive they will be impacted.
BMC Complement Altern Med. 2006;618.
BACKGROUND: New Canadian policy to regulate natural health products (NHPs), such as herbs and vitamins were implemented on January 1st, 2004. We explored complementary and alternative medicine (CAM) practitioners' perceptions of how the new regulations may affect their practices and relationships with patients/consumers. METHODS: This was an applied ethnographic study. Data were collected in fall 2004 via qualitative interviews with 37 Canadian leaders of four CAM groups that use natural products as a core part of their practises: naturopathic medicine, traditional Chinese medicine (TCM), homeopathic medicine and Western herbalism. All interviews were transcribed verbatim and coded independently by a minimum of two investigators using content analysis. RESULTS: Three key findings emerged from the data: 1) all CAM leaders were concerned with issues of their own access to NHPs; 2) all the CAM leaders, except for the homeopathic leaders, specifically indicated a desire to have a restricted schedule of NHPs; and 3) only naturopathic leaders were concerned the NHP regulations could potentially endanger patients if they self-medicate incorrectly. CONCLUSION: Naturopaths, TCM practitioners, homeopaths, and Western herbalists were all concerned about how the new NHP regulations will affect their access to the products they need to practice effectively. Additional research will need to focus on what impacts actually occur as the regulations are implemented more fully. [Abstract/Link to Full Text]

Rao NK, Nammi S
Antidiabetic and renoprotective effects of the chloroform extract of Terminalia chebula Retz. seeds in streptozotocin-induced diabetic rats.
BMC Complement Altern Med. 2006;617.
BACKGROUND: Terminalia chebula (Combretaceae) has been widely used in Ayurveda for the treatment of diabetes. In the present investigation, the chloroform extract of T. chebula seed powder was investigated for its antidiabetic activity in streptozotocin-induced diabetic rats using short term and long term study protocols. The efficacy of the extract was also evaluated for protection of renal functions in diabetic rats. METHODS: The blood glucose lowering activity of the chloroform extract was determined in streptozotocin-induced (75 mg/kg, i.p.; dissolved in 0.1 M acetate buffer; pH 4.5) diabetic rats, after oral administration at the doses of 100, 200 and 300 mg/kg in short term study. Blood samples were collected from the eye retro-orbital plexus of rats before and also at 0.5, 1, 2, 4, 6, 8 and 12 h after drug administration and the samples were analyzed for blood glucose by using glucose-oxidase/peroxidase method using a visible spectrophotometer. In long term study, the extract (300 mg/kg) was administered to streptozotocin-induced diabetic rats, daily for 8 weeks. Blood glucose was measured at weekly intervals for 4 weeks. Urine samples were collected before the induction of diabetes and at the end of 8 weeks of treatments and analyzed for urinary protein, albumin and creatinine levels. The data was compared statistically using one-way ANOVA with post-hoc Dunnet's t-test. RESULTS: The chloroform extract of T. chebula seeds produced dose-dependent reduction in blood glucose of diabetic rats and comparable with that of standard drug, glibenclamide in short term study. It also produced significant reduction in blood glucose in long term study. Significant renoprotective activity is observed in T. chebula treated rats. The results indicate a prolonged action in reduction of blood glucose by T. chebula and is probably mediated through enhanced secretion of insulin from the beta-cells of Langerhans or through extra pancreatic mechanism. The probable mechanism of potent renoprotective actions of T. chebula has to be evaluated. CONCLUSION: The present studies clearly indicated a significant antidiabetic and renoprotective effects with the chloroform extract of T. chebula and lend support for its traditional usage. Further investigations on identification of the active principles and their mode of action are needed to unravel the molecular mechanisms involved in the observed effects. [Abstract/Link to Full Text]

Crawford NW, Cincotta DR, Lim A, Powell CV
A cross-sectional survey of complementary and alternative medicine use by children and adolescents attending the University Hospital of Wales.
BMC Complement Altern Med. 2006;616.
BACKGROUND: A high prevalence of CAM use has been documented worldwide in children and adolescents with chronic illnesses. Only a small number of studies, however, have been conducted in the United Kingdom. The primary aim of this study was to examine the use of CAM by children and adolescents with a wide spectrum of acute and chronic medical problems in a tertiary children's hospital in Wales. METHODS: Structured personal interviews of 100 inpatients and 400 outpatients were conducted over a 2-month period in 2004. The yearly and monthly prevalence of CAM use were assessed and divided into medicinal and non-medicinal therapies. This use was correlated with socio-demographic factors. RESULTS: There were 580 patients approached to attain 500 completed questionnaires. The use of at least one type of CAM in the past year was 41% (95% CI 37-46%) and past month 26% (95% CI 23-30%). The yearly prevalence of medicinal CAM was 38% and non-medicinal 12%. The users were more likely to have parents that were tertiary educated (mother: OR = 2.3, 95%CI 1.6-3.3) and a higher family income (Pearson chi-square for trend = 14.3, p < 0.001). The most common medicinal types of CAM were non-prescribed vitamins and minerals (23%) and herbal therapies (10%). Aromatherapy (5%) and reflexology (3%) were the most prevalent non-medicinal CAMs.None of the inpatient medical records documented CAM use in the past month. Fifty-two percent of medicinal and 38% of non-medicinal CAM users felt their doctor did not need to know about CAM use. Sixty-six percent of CAM users did not disclose the fact to their doctor. Three percent of all participants were using herbs and prescription medicines concurrently. CONCLUSION: There is a high prevalence of CAM use in our study population. Paediatricians need to ensure that they ask parents and older children about their CAM usage and advise caution with regard to potential interactions.CAM is a rapidly expanding industry that requires further evidence-based research to provide more information on the effectiveness and safety of many CAM therapies. Statutory or self-regulation of the different segments of the industry is important. Integration of CAM with allopathic western medicine through education and better communication is slowly progressing. [Abstract/Link to Full Text]

Kemper KJ, Gardiner P, Gobble J, Woods C
Expertise about herbs and dietary supplements among diverse health professionals.
BMC Complement Altern Med. 2006;615.
BACKGROUND: Herbs and other dietary supplements are among the most commonly used complementary medical therapies. However, clinicians generally have limited knowledge, confidence and communication about herbs and dietary supplements (HDS). We compared diverse clinicians' expertise about HDS to better target future curricula. METHODS: We conducted a cross-sectional survey of physicians, pharmacists, nurses, dietitians and trainees in these professions prior to e-curriculum about HDS in 2004-2005. The survey had 28 questions about knowledge, 19 questions about their confidence and 11 questions about their communication practices about HDS. RESULTS: Of the 1,268 participants, 25% were male; the average age was 40 years. Mean scores were 66% correct for knowledge; 53/95 on the confidence scale and 2.2 out of possible 10 on the communication practices scale. On average, scores were lowest for those who used fewer HDS; and trainees and nurses compared with physicians, pharmacists and dietitians (P < 0.01 for all comparisons). CONCLUSION: Clinicians have moderate levels of knowledge and confidence, but poor communication skills about HDS. Future curricula about HDS should target nurses, students, practitioners and those not currently using HDS. Research is needed to determine the most cost-effective educational strategies for diverse health professionals. [Abstract/Link to Full Text]

Vas J, Perea-Milla E, Mendez C, Silva LC, Herrera Galante A, Aranda Regules JM, Martinez Barquin DM, Aguilar I, Faus V
Efficacy and safety of acupuncture for the treatment of non-specific acute low back pain: a randomised controlled multicentre trial protocol [ISRCTN65814467].
BMC Complement Altern Med. 2006;614.
BACKGROUND: Low back pain and its associated incapacitating effects constitute an important healthcare and socioeconomic problem, as well as being one of the main causes of disability among adults of working age. The prevalence of non-specific low back pain is very high among the general population, and 60-70% of adults are believed to have suffered this problem at some time. Nevertheless, few randomised clinical trials have been made of the efficacy and efficiency of acupuncture with respect to acute low back pain. The present study is intended to assess the efficacy of acupuncture for acute low back pain in terms of the improvement reported on the Roland Morris Questionnaire (RMQ) on low back pain incapacity, to estimate the specific and non-specific effects produced by the technique, and to carry out a cost-effectiveness analysis. METHODS/DESIGN: Randomised four-branch controlled multicentre prospective study made to compare semi-standardised real acupuncture, sham acupuncture (acupuncture at non-specific points), placebo acupuncture and conventional treatment. The patients are blinded to the real, sham and placebo acupuncture treatments. Patients in the sample present symptoms of non specific acute low back pain, with a case history of 2 weeks or less, and will be selected from working-age patients, whether in paid employment or not, referred by General Practitioners from Primary Healthcare Clinics to the four clinics participating in this study. In order to assess the primary and secondary result measures, the patients will be requested to fill in a questionnaire before the randomisation and again at 3, 12 and 48 weeks after starting the treatment. The primary result measure will be the clinical relevant improvement (CRI) at 3 weeks after randomisation. We define CRI as a reduction of 35% or more in the RMQ results. DISCUSSION: This study is intended to obtain further evidence on the effectiveness of acupuncture on acute low back pain and to isolate the specific and non-specific effects of the treatment. [Abstract/Link to Full Text]

Miller MJ, Ahmed S, Bobrowski P, Haqqi TM
The chrondoprotective actions of a natural product are associated with the activation of IGF-1 production by human chondrocytes despite the presence of IL-1beta.
BMC Complement Altern Med. 2006;613.
BACKGROUND: Cartilage loss is a hallmark of arthritis and follows activation of catabolic processes concomitant with a disruption of anabolic pathways like insulin-like growth factor 1 (IGF-1). We hypothesized that two natural products of South American origin, would limit cartilage degradation by respectively suppressing catabolism and activating local IGF-1 anabolic pathways. One extract, derived from cat's claw (Uncaria guianensis, vincaria), is a well-described inhibitor of NF-kappaB. The other extract, derived from the vegetable Lepidium meyenii (RNI 249), possessed an uncertain mechanism of action but with defined ethnomedical applications for fertility and vitality. METHODS: Human cartilage samples were procured from surgical specimens with consent, and were evaluated either as explants or as primary chondrocytes prepared after enzymatic digestion of cartilage matrix. Assessments included IGF-1 gene expression, IGF-1 production (ELISA), cartilage matrix degradation and nitric oxide (NO) production, under basal conditions and in the presence of IL-1beta. RESULTS: RNI 249 enhanced basal IGF-1 mRNA levels in human chondrocytes by 2.7 fold, an effect that was further enhanced to 3.8 fold by co-administration with vincaria. Enhanced basal IGF-1 production by RNI 249 alone and together with vincaria, was confirmed in both explants and in primary chondrocytes (P < 0.05). As expected, IL-1beta exposure completely silenced IGF-1 production by chondrocytes. However, in the presence of IL-1beta both RNI 249 and vincaria protected IGF-1 production in an additive manner (P < 0.01) with the combination restoring chondrocyte IGF-1 production to normal levels. Cartilage NO production was dramatically enhanced by IL-1beta. Both vincaria and RNI 249 partially attenuated NO production in an additive manner (p < 0.05). IL-1beta - induced degradation of cartilage matrix was quantified as glycosaminoglycan release. Individually RNI 249 or vincaria, prevented this catabolic action of IL-1beta. CONCLUSION: The identification of agents that activate the autocrine production of IGF-1 in cartilage, even in the face of suppressive pro-inflammatory, catabolic cytokines like IL-1beta, represents a novel therapeutic approach to cartilage biology. Chondroprotection associated with prevention of the catabolic events and the potential for sustained anabolic activity with this natural product suggests that it holds significant promise in the treatment of debilitating joint diseases. [Abstract/Link to Full Text]

Nayak S, Nalabothu P, Sandiford S, Bhogadi V, Adogwa A
Evaluation of wound healing activity of Allamanda cathartica. L. and Laurus nobilis. L. extracts on rats.
BMC Complement Altern Med. 2006;612.
BACKGROUND: Allamanda cathartica. L. is a perennial shrub used in traditional medicine for treating malaria and jaundice. Laurus nobilis. L. is a tree and has been used for its astringent, healing and diuretic properties. The objective of this study was to investigate the aqueous extracts of Allamanda and Laurus nobilis to evaluate their wound healing activity in rats. METHODS: Excision and incision wound models were used to evaluate the wound healing activity of both the extracts on Sprague Dawley rats. In each model, animals were divided into four groups of 10 animals each. In both the model, group 1 served as control and group 2 as reference standard. In an excision wound model, group 3 animals were treated with Allamanda (150 mg kg(-1) day(-1)) and group 4 animals were treated with Laurus nobilis (200 mg kg(-1) b.w day(-1)) for 14 days respectively. In the case of incision wound model, group 3 and 4 animals were treated with the extracts of Allamanda and Laurus respectively for 10 days. The effects of vehicles on the rate of wound healing were assessed by the rate of wound closure, period of epithelialisation, tensile strength, weights of the granulation tissue, hydroxyproline content and histopathology of the granulation tissue. RESULTS: The aqueous extract of Allamanda promoted wound healing activity significantly in both the wound models studied. High rate of wound contraction (P < .001), decrease in the period of epithelialisation (10.2 +/- 0.13), high skin breaking strength (440.0 +/- 4.53), significant increase in the weight of the granulation tissue (P < .001) and hydroxyproline (P < .001) content were observed in animals treated with the aqueous extract of Allamanda. Histological studies of the granulation tissue from the Allamanda treated group showed the presence of a lesser number of inflammatory cells, and increased collagen formation than the control. In Laurus nobilis treated animals, the rate of wound contraction, weight of the granulation tissue and hydroxyproline content were moderately high (P < .05). The histological study of the granulation tissue of the Laurus nobilis treated animals showed larger number of inflammatory cells, and lesser collagen when compared with the Allamanda treated group of animals. However, it was better than the control group of animals. CONCLUSION: The data of this study indicated that the leaf extract of Allamanda possesses better wound healing activity than the Laurus nobilis and it can be used to treat different types of wounds in human beings too. [Abstract/Link to Full Text]

Runyoro DK, Matee MI, Ngassapa OD, Joseph CC, Mbwambo ZH
Screening of Tanzanian medicinal plants for anti-Candida activity.
BMC Complement Altern Med. 2006;611.
BACKGROUND: Candida albicans has become resistant to the already limited, toxic and expensive anti-Candida agents available in the market. These factors necessitate the search for new anti-fungal agents. METHODS: Sixty-three plant extracts, from 56 Tanzanian plant species obtained through the literature and interviews with traditional healers, were evaluated for anti-Candida activity. Aqueous methanolic extracts were screened for anti-Candida activity by bioautography agar overlay method, using a standard strain of Candida albicans (ATCC 90028). RESULTS: Twenty- seven (48%) out of the 56 plants were found to be active. Extracts of the root barks of Albizia anthelmintica and Balanites aegyptiaca, and roots of Plectranthus barbatus showed strong activity. CONCLUSION: The extracts that showed strong anti-Candida activity are worth of further investigation in order to isolate and identify the active compounds. [Abstract/Link to Full Text]

Shimoda H, Seki E, Aitani M
Inhibitory effect of green coffee bean extract on fat accumulation and body weight gain in mice.
BMC Complement Altern Med. 2006;69.
BACKGROUND: An epidemiological study conducted in Italy indicated that coffee has the greatest antioxidant capacity among the commonly consumed beverages. Green coffee bean is rich in chlorogenic acid and its related compounds. The effect of green coffee bean extract (GCBE) on fat accumulation and body weight in mice was assessed with the objective of investigating the effect of GCBE on mild obesity. METHODS: Male ddy mice were fed a standard diet containing GCBE and its principal constituents, namely, caffeine and chlorogenic acid, for 14 days. Further, hepatic triglyceride (TG) level was also investigated after consecutive administration (13 days) of GCBE and its constituents. To examine the effect of GCBE and its constituents on fat absorption, serum TG changes were evaluated in olive oil-loaded mice. In addition, to investigate the effect on hepatic TG metabolism, carnitine palmitoyltransferase (CPT) activity in mice was evaluated after consecutive ingestion (6 days) of GCBE and its constituents (caffeine, chlorogenic acid, neochlorogenic acid and feruloylquinic acid mixture). RESULTS: It was found that 0.5% and 1% GCBE reduced visceral fat content and body weight. Caffeine and chlorogenic acid showed a tendency to reduce visceral fat and body weight. Oral administration of GCBE (100 and 200 mg/kg. day) for 13 days showed a tendency to reduce hepatic TG in mice. In the same model, chlorogenic acid (60 mg/kg. day) reduced hepatic TG level. In mice loaded with olive oil (5 mL/kg), GCBE (200 and 400 mg/kg) and caffeine (20 and 40 mg/kg) reduced serum TG level. GCBE (1%), neochlorogenic acid (0.028% and 0.055%) and feruloylquinic acid mixture (0.081%) significantly enhanced hepatic CPT activity in mice. However, neither caffeine nor chlorogenic acid alone was found to enhance CPT activity. CONCLUSION: These results suggest that GCBE is possibly effective against weight gain and fat accumulation by inhibition of fat absorption and activation of fat metabolism in the liver. Caffeine was found to be a suppressor of fat absorption, while chlorogenic acid was found to be partially involved in the suppressive effect of GCBE that resulted in the reduction of hepatic TG level. Phenolic compounds such as neochlorogenic acid and feruloylquinic acid mixture, except chlorogenic acid, can enhance hepatic CPT activity. [Abstract/Link to Full Text]

Lao CD, Ruffin MT, Normolle D, Heath DD, Murray SI, Bailey JM, Boggs ME, Crowell J, Rock CL, Brenner DE
Dose escalation of a curcuminoid formulation.
BMC Complement Altern Med. 2006;610.
BACKGROUND: Curcumin is the major yellow pigment extracted from turmeric, a commonly-used spice in India and Southeast Asia that has broad anticarcinogenic and cancer chemopreventive potential. However, few systematic studies of curcumin's pharmacology and toxicology in humans have been performed. METHODS: A dose escalation study was conducted to determine the maximum tolerated dose and safety of a single dose of standardized powder extract, uniformly milled curcumin (C3 Complextrade mark, Sabinsa Corporation). Healthy volunteers were administered escalating doses from 500 to 12,000 mg. RESULTS: Seven of twenty-four subjects (30%) experienced only minimal toxicity that did not appear to be dose-related. No curcumin was detected in the serum of subjects administered 500, 1,000, 2,000, 4,000, 6,000 or 8,000 mg. Low levels of curcumin were detected in two subjects administered 10,000 or 12,000 mg. CONCLUSION: The tolerance of curcumin in high single oral doses appears to be excellent. Given that achieving systemic bioavailability of curcumin or its metabolites may not be essential for colorectal cancer chemoprevention, these findings warrant further investigation for its utility as a long-term chemopreventive agent. [Abstract/Link to Full Text]

Sundararajan R, Haja NA, Venkatesan K, Mukherjee K, Saha BP, Bandyopadhyay A, Mukherjee PK
Cytisus scoparius link--a natural antioxidant.
BMC Complement Altern Med. 2006;68.
BACKGROUND: Recent investigations have shown that the antioxidant properties of plants could be correlated with oxidative stress defense and different human diseases. In this respect flavonoids and other polyphenolic compounds have gained the greatest attention. The plant Cytisus scoparius contains the main constituent of flavone and flavonals. The present study was undertaken to evaluate the in vitro antioxidant activities of extract of aerial part of Cytisus scoparius. METHODS: The plant extract was tested for DPPH (1, 1-diphenyl, 2-picryl hydrazyl) radical scavenging, nitric oxide radical scavenging, superoxide anion radical scavenging, hydroxyl radical scavenging, antilipid peroxidation assay, reducing power and total phenol content. RESULTS: The extract exhibited scavenging potential with IC50 value of 1.5 microg/ml, 116.0 microg/ml and 4.7 microg/ml for DPPH, nitric oxide and superoxide anion radicals. The values were found to lesser than those of vitamin C, rutin, and curcumin, as standards. The extract showed 50% protection at the dose of 104.0 microg/ml in lipid peroxidation induced by Fe2+/ ascorbate system in rat liver microsomal preparation. There is decrease in hydroxyl radical generation with IC50 value of 27.0 microg/ml when compared with standard vitamin E. The reducing power of the extract depends on the amount of extract. A significant amount of polyphenols could be detected by the equivalent to 0.0589 microg of pyrocatechol from 1 mg of extract. CONCLUSION: The results obtained in the present study indicate that hydro alcoholic extract of aerial part of Cytisus scoparius is a potential source of natural antioxidants. [Abstract/Link to Full Text]

Paterson C
Measuring changes in self-concept: a qualitative evaluation of outcome questionnaires in people having acupuncture for their chronic health problems.
BMC Complement Altern Med. 2006;67.
BACKGROUND: Changes in self-concept are an important potential outcome for many interventions for people with long-term conditions. This study sought to identify and evaluate outcome questionnaires suitable for quantifying changes in self-concept in people with long-term conditions, in the context of treatment with acupuncture and Chinese medicine. METHODS: A literature search was followed by an evaluation of three questionnaires: The Wellbeing Questionnaire W-BQ12, the Patient Enablement Instrument (PEI), and the Arizona Integrative Outcome Scale (AIOS). A convenience sample of 23 people completed the questionnaires on two occasions and were interviewed about their experience and their questionnaire responses. All acupuncturists were interviewed. RESULTS: Changes in self-concept were common and emerged over time. The three questionnaires had different strengths and weaknesses in relation to measuring changes in self-concept. The generic AIOS had face validity and was sensitive to changes in self-concept over time, but it lacked specificity. The PEI was sensitive and specific in measuring these changes but had lower acceptability. The sensitivity of the W-BQ12 was affected by initial high scores (ceiling effect) and a shorter timescale but was acceptable and is suitable for repeated administration. The PEI and W-BQ12 questionnaires worked well in combination. CONCLUSION: Changes in self-concept are important outcomes of complex interventions for people with long-term illness and their measurement requires carefully evaluated tools and long-term follow-up. The literature review and the analysis of the strengths and weaknesses of the questionnaires is a resource for other researchers. The W-BQ12 and the PEI both proved useful for this population and a larger quantitative study is planned. [Abstract/Link to Full Text]

Ezz El-Arab AM, Girgis SM, Hegazy EM, Abd El-Khalek AB
Effect of dietary honey on intestinal microflora and toxicity of mycotoxins in mice.
BMC Complement Altern Med. 2006;66.
BACKGROUND: Bee honey is a functional food which has a unique composition, antimicrobial properties and bifidogenic effect. In order to assess whether honey can inhibit the toxic effect of mycotoxins, the present study was undertaken. METHODS: Production of biomass and toxins by Aspergillus parasiticus and Aspergillus ochraceus were followed in media without and with honey. Although aflatoxins and ochratoxin A. were administrated to male Swiss albino mice up to 1 mug and 10 ng/kg body weight/day respectively. The experimental animals were fed diets without our with 10% honey for two months. The changes in colonic probiotic bacteria, determintal colon enzyme glucuronidases, and genotoxicity were followed. RESULTS: Addition of 32% in its media increased the biomass of A parasiticus, while the biomass of A. ochraceus decreased and Ochratoxin A. was not produced. When the honey was added at the ratio of 32 and 48% in the medium. No relationship was found between mycelium weight and production of mycotoxins. Oral administration of aflatoxins (mixture of B1, B2, G1 and G2) and Ochratoxin A. induced structural and numerical chromosomal aberrations in bone marrow and germ cells of male mice, whereas, honey treatment reduced the genotoxicity of mycotoxins. Also both toxins induced histopathological changes in liver and kidney. Feeding on diet supplemented with honey improved the histopathological changes in case of aflatoxin group, but not in the case of ochratoxin A. group (except of kidney in two cases). No significant differences were found in the activity of colon beta-glucuronidase between group fed diet with or without honey. On the other hand, the colon bifido bacteria and lactobacilli counts were increased markedly in group receiving diet supplemented with honey. CONCLUSION: Substituting sugars with honey in processed food can inhibit the harmful and genotoxic effects of mycotoxins, and improve the gut microflora. [Abstract/Link to Full Text]

Greene BR, Smith M, Allareddy V, Haas M
Referral patterns and attitudes of primary care physicians towards chiropractors.
BMC Complement Altern Med. 2006;65.
BACKGROUND: Despite the increasing usage and popularity of chiropractic care, there has been limited research conducted to examine the professional relationships between conventional trained primary care physicians (PCPs) and chiropractors (DCs). The objectives of our study were to contrast the intra-professional referral patterns among PCPs with referral patterns to DCs, and to identify predictors of PCP referral to DCs. METHODS: We mailed a survey instrument to all practicing PCPs in the state of Iowa. Descriptive statistics were used to summarize their responses. Multivariable logistic regression analyses were conducted to identify demographic factors associated with inter-professional referral behaviors. RESULTS: A total of 517 PCPs (33%) participated in the study. PCPs enjoyed strong intra-professional referral relationships with other PCPs. Although patients exhibited a great deal of interest in chiropractic care, PCPs were unlikely themselves to make formal referral relationships with DCs. PCPs in a private practice arrangement were more likely to exhibit positive referral attitudes towards DCs (p = 0.01). CONCLUSION: PCPs enjoy very good professional relationships with other PCPs. However, the lack of direct formalized referral relationships between PCPs and chiropractors has implications for efficiency, continuity, quality, and patient safety in the health care delivery system. Future research must focus on identifying facilitators and barriers for developing positive relationships between PCPs and chiropractors. [Abstract/Link to Full Text]

Tai S, Wang J, Sun F, Xutian S, Wang T, King M
Effect of needle puncture and electro-acupuncture on mucociliary clearance in anesthetized quails.
BMC Complement Altern Med. 2006;64.
BACKGROUND: Acupuncture therapy for obstructive respiratory diseases has been effectively used in clinical practice and the acupuncture points or acupoints of Zhongfu and Tiantu are commonly-used acupoints to treat patients with the diseases. Since the impaired mucociliary clearance is among the most important features of airway inflammation in most obstructive respiratory diseases, the effect of needle puncture and electro-acupuncture at the specific acupoints on tracheal mucociliary clearance was investigated in anesthetized quails. METHODS: Mucociliary transport velocity on tracheal mucosa was measured through observing the optimal pathway, and fucose and protein contents in tracheal lavages were determined with biochemical methods. In the therapeutic group, needle puncture or electro-acupuncture stimulation to the acupoints was applied without or with constant current output in 2 mA and at frequency of 100 Hz for 60 minutes. In the sham group, electro-acupuncture stimulation to Liangmen was applied. RESULTS: Our present experiments demonstrated that the electro-acupuncture stimulation to Zhongfu and Tiantu significantly increased tracheal mucociliary transport velocity and decreased the content of protein in the tracheal lavage, compared with the control group. Moreover, either needle puncture or electro-acupuncture stimulation to Zhongfu and Tiantu significantly reverted the human neutrophil elastase-induced decrease in tracheal mucociliary transport velocity and human neutrophil elastase -induced increase in the contents of fucose and protein in the tracheal lavage, compared with the control group. CONCLUSION: These results suggest that either needle puncture or electro-acupuncture stimulation to the effective acupoints significantly improves both airway mucociliary clearance and the airway surface liquid and that the improvements maybe ascribed to both the special function of the points and the substantial stimulation of electricity. [Abstract/Link to Full Text]

Mohanty I, Arya DS, Gupta SK
Effect of Curcuma longa and Ocimum sanctum on myocardial apoptosis in experimentally induced myocardial ischemic-reperfusion injury.
BMC Complement Altern Med. 2006;63.
BACKGROUND: In the present investigation, the effect of Curcuma longa (Cl) and Ocimum sanctum (Os) on myocardial apoptosis and cardiac function was studied in an ischemia and reperfusion (I-R) model of myocardial injury. METHODS: Wistar albino rats were divided into four groups and orally fed saline once daily (sham, control IR) or Cl (100 mg/kg; Cl-IR) or Os (75 mg/kg; Os-IR) respectively for 1 month. On the 31st day, in the rats of the control IR, Cl-IR and Os-IR groups LAD occlusion was undertaken for 45 min, and reperfusion was allowed for 1 h. The hemodynamic parameters{mean arterial pressure (MAP), heart rate (HR), left ventricular end-diastolic pressure (LVEDP), left ventricular peak positive (+) LVdP/dt (rate of pressure development) and negative (-) LVdP/dt (rate of pressure decline)} were monitored at pre-set points throughout the experimental duration and subsequently, the animals were sacrificed for immunohistopathological (Bax, Bcl-2 protein expression & TUNEL positivity) and histopathological studies. RESULTS: Chronic treatment with Cl significantly reduced TUNEL positivity (p < 0.05), Bax protein (p < 0.001) and upregulated Bcl-2 (p < 0.001) expression in comparison to control IR group. In addition, Cl demonstrated mitigating effects on several myocardial injury induced hemodynamic {(+)LVdP/dt, (-) LVdP/dt & LVEDP} and histopathological perturbations. Chronic Os treatment resulted in modest modulation of the hemodynamic alterations (MAP, LVEDP) but failed to demonstrate any significant antiapoptotic effects and prevent the histopathological alterations as compared to control IR group. CONCLUSION: In the present study, significant cardioprotection and functional recovery demonstrated by Cl may be attributed to its anti-apoptotic property. In contrast to Os, Cl may attenuate cell death due to apoptosis and prevent the impairment of cardiac performance. [Abstract/Link to Full Text]

Rojas JJ, Ochoa VJ, Ocampo SA, Mu�oz JF
Screening for antimicrobial activity of ten medicinal plants used in Colombian folkloric medicine: a possible alternative in the treatment of non-nosocomial infections.
BMC Complement Altern Med. 2006;62.
BACKGROUND: The antimicrobial activity and Minimal Inhibitory Concentration (MIC) of the extracts of Bidens pilosa L., Bixa orellana L., Cecropia peltata L., Cinchona officinalis L., Gliricidia sepium H.B. & K, Jacaranda mimosifolia D.Don, Justicia secunda Vahl., Piper pulchrum C.DC, P. paniculata L. and Spilanthes americana Hieron were evaluated against five bacteria (Staphylococcus aureus, Streptococcus beta hemol�tic, Bacillus cereus, Pseudomonas aeruginosa, and Escherichia coli), and one yeast (Candida albicans). These plants are used in Colombian folk medicine to treat infections of microbial origin. METHODS: Plants were collected by farmers and traditional healers. The ethanol, hexane and water extracts were obtained by standard methods. The antimicrobial activity was found by using a modified agar well diffusion method. All microorganisms were obtained from the American Type Culture Collection (ATCC). MIC was determined in the plant extracts that showed some efficacy against the tested microorganisms. Gentamycin sulfate (1.0 microg/ml), clindamycin (0.3 microg/ml) and nystatin (1.0 microg/ml) were used as positive controls. RESULTS: The water extracts of Bidens pilosa L., Jacaranda mimosifolia D.Don, and Piper pulchrum C.DC showed a higher activity against Bacillus cereus and Escherichia coli than gentamycin sulfate. Similarly, the ethanol extracts of all species were active against Staphylococcus aureus except for Justicia secunda. Furthermore, Bixa orellana L, Justicia secunda Vahl. and Piper pulchrum C.DC presented the lowest MICs against Escherichia coli (0.8, 0.6 and 0.6 microg/ml, respectively) compared to gentamycin sulfate (0.9 8 g/ml). Likewise, Justicia secunda and Piper pulchrum C.DC showed an analogous MIC against Candida albicans (0.5 and 0.6 microg/ml, respectively) compared to nystatin (0.6 microg/ml). Bixa orellana L, exhibited a better MIC against Bacillus cereus (0.2 microg/ml) than gentamycin sulfate (0.5 microg/ml). CONCLUSION: This in vitro study corroborated the antimicrobial activity of the selected plants used in folkloric medicine. All these plants were effective against three or more of the pathogenic microorganisms. However, they were ineffective against Streptococcus beta hemolytic and Pseudomonas aeruginosa. Their medicinal use in infections associated with these two species is not recommended. This study also showed that Bixa orellana L, Justicia secunda Vahl. and Piper pulchrum C.DC could be potential sources of new antimicrobial agents. [Abstract/Link to Full Text]

Mani S, Lawson JW
In vitro modulation of inflammatory cytokine and IgG levels by extracts of Perna canaliculus.
BMC Complement Altern Med. 2006;61.
BACKGROUND: Inflammation is a predominant characteristic of autoimmune diseases which is characterized by the increased expression of pro-inflammatory cytokines. Soon to be published work from our laboratory has shown that ingestion of Perna canaliculus prevents the development of autoimmune diseases such as Systemic Lupus Erythematosus and rheumatoid arthritis in laboratory animals. The current paper attempts to illustrate how Perna can alleviate inflammation by modulating inflammatory cytokines, cyclooxygenase enzymes and Immunoglobulin-G (IgG) levels. METHODS: In the present study, hydrochloric acid [HCl] and Tween-20 were used to develop extracts of Perna. These extracts were assayed for protein content. Increasing concentrations of these extracts were then tested in cell culture for modulation of inflammatory cytokine, cyclooxygenase enzymes and IgG levels. Parallel tests were run using an available glycogen extract of Perna as a comparison to our in-house laboratory preparations. RESULTS: Tween-20 Perna extracts were found to be more stable and less toxic in cell culture than HCl digest of Perna. They also assayed higher in protein content that HCl extracts. Although both extracts inhibited IgG production in V2E9 hybridomas, Tween-20 extracts were more consistent in IgG suppression than HCl extracts. Overall Tween-20 extracts effectively decreased levels of TNF-alpha, IL-1, IL-2 and IL-6 as observed using cytokine bioassays. Twenty micrograms of Tween-20 Perna extracts induced such significant decreases in inflammatory cytokine production that when tested on sensitive cell lines, they very nearly abolished the decrease in viability induced by these cytokines. Tween-20 extracts effectively inhibited both COX-1 and COX-2 cyclooxygenase activity. As a comparison, the glycogen extract also demonstrated a similar though weaker effect on COX-1 and COX-2 enzymes. The active components of both extracts (Tween-20 and glycogen) were observed to possess molecular weights above 100 kDa. Although the anti-cytokine activity of the Tween-20 extract was destroyed by Proteinase-K treatment, the anti-COX-1 and anti-COX-2 activity of both the extracts were not sensitive to protease treatment. CONCLUSION: We have successfully demonstrated modulation in the levels of inflammatory cytokines, cyclooxygenase enzymes and immunoglobulins by our in-house laboratory preparations of Perna canaliculus, whereby suggesting an immunomodulatory role of Perna canaliculus in regulating inflammation. [Abstract/Link to Full Text]

Michalsen A, Riegert M, L�dtke R, B�cker M, Langhorst J, Schwickert M, Dobos GJ
Mediterranean diet or extended fasting's influence on changing the intestinal microflora, immunoglobulin A secretion and clinical outcome in patients with rheumatoid arthritis and fibromyalgia: an observational study.
BMC Complement Altern Med. 2005;522.
BACKGROUND: Alterations in the intestinal bacterial flora are believed to be contributing factors to many chronic inflammatory and degenerative diseases including rheumatic diseases. While microbiological fecal culture analysis is now increasingly used, little is known about the relationship of changes in intestinal flora, dietary patterns and clinical outcome in specific diseases. To clarify the role of microbiological culture analysis we aimed to evaluate whether in patients with rheumatoid arthritis (RA) or fibromyalgia (FM) a Mediterranean diet or an 8-day fasting period are associated with changes in fecal flora and whether changes in fecal flora are associated with clinical outcome. METHODS: During a two-months-period 51 consecutive patients from an Integrative Medicine hospital department with an established diagnosis of RA (n = 16) or FM (n = 35) were included in the study. According to predefined clinical criteria and the subjects' choice the patients received a mostly vegetarian Mediterranean diet (n = 21; mean age 50.9 +/-13.3 y) or participated in an intermittent modified 8-day fasting therapy (n = 30; mean age 53.7 +/- 9.4 y). Quantitative aerob and anaerob bacterial flora, stool pH and concentrations of secretory immunoglobulin A (sIgA) were analysed from stool samples at the beginning, at the end of the 2-week hospital stay and at a 3-months follow-up. Clinical outcome was assessed with the DAS 28 for RA patients and with a disease severity rating scale in FM patients. RESULTS: We found no significant changes in the fecal bacterial counts following the two dietary interventions within and between groups, nor were significant differences found in the analysis of sIgA and stool ph. Clinical improvement at the end of the hospital stay tended to be greater in fasting vs. non-fasting patients with RA (p = 0.09). Clinical outcome was not related to alterations in the intestinal flora. CONCLUSION: Neither Mediterranean diet nor fasting treatments affect the microbiologically assessed intestinal flora and sIgA levels in patients with RA and FM. The impact of dietary interventions on the human intestinal flora and the role of the fecal flora in rheumatic diseases have to be clarified with newer molecular analysis techniques. The potential benefit of fasting treatment in RA and FM should be further tested in randomised trials. [Abstract/Link to Full Text]

Watanabe E, Fukuda S, Shirakawa T
Effects among healthy subjects of the duration of regularly practicing a guided imagery program.
BMC Complement Altern Med. 2005;521.
BACKGROUND: We examined a large number of healthy adults in the general community who had individually participated in a guided imagery (GI) program daily and for various durations, to examine the psychophysiological effects of a GI program within a healthy group. METHODS: We studied 176 subjects who had participated in sessions that were part of a guided imagery program, and who had practiced GI at home for 20 minutes once daily in a quiet place after mastering GI in the group sessions. The average duration of GI practiced at home was 6.88 +/- 14.06 months (n = 138, range: 0 to 72). The Multiple Mood Scale (MMS), Betts (1909) Shortened Questionnaire on Mental Imagery (QMI), and a visual analog scale (VAS) of imagery vividness, salivary cortisol (CS) levels, general stress and general health were used in the sessions. RESULTS: We examined the relationship between the duration of daily GI practiced at home and MMS, QMI, CS, general health, and general stress at baseline. The subjects who had practiced GI at home longer had lower negative mood scores at baseline and lower severity of stress, and higher positive mood at baseline (both at a session and at home), general health, and QMI scores at baseline. The MMS change during a session and the duration of daily GI practiced at home were not correlated. Repeated-measures analysis of covariance showed that the duration of daily GI practiced as the covariate was not associated with changes in the three CS levels. CONCLUSION: Although regularly practicing a GI program daily for 20 min did not affect the CS level or mood during a GI session for several hours, it kept a good condition of the general mental, physical well-being and their overall stress of the practitioners as they had practiced it for long duration. We postulate that subjects who have the high ability of imaging vividness showed the better mood, health status and less stress than those subjects who have the low ability of it did. The ability of image vividness of the long-term regular practitioners of GI was higher than its short-term or inexperienced practitioners, which allowed practitioners to produce more comfortable imagery. Consequently, the longer the duration that they had practiced GI program once a day regularly, the lower scores of their stress were and the higher scores of their health were. We suggest that the regular daily practice of a GI program might be connected to less stress and better health. [Abstract/Link to Full Text]

Clement YN, Williams AF, Khan K, Bernard T, Bhola S, Fortun� M, Medupe O, Nagee K, Seaforth CE
A gap between acceptance and knowledge of herbal remedies by physicians: the need for educational intervention.
BMC Complement Altern Med. 2005;520.
BACKGROUND: The unprecedented global increase in the use of herbal remedies is set to continue apace well into the foreseeable future. This raises important public health concerns, especially as it relates to safety issues including adverse effects and herb-drug interactions. Most Western-trained physicians are ignorant of the risks and benefits of this healthcare modality and assessment of acceptance and knowledge would identify appropriate intervention strategies to improve physician-patient communication in this area. METHODS: A cross-sectional survey was done using an interviewer-administered pilot tested de novo questionnaire at six public hospitals in Trinidad between May-July 2004. The questionnaire utilized weighed questions to quantify acceptance (maximum score = 14 points) and knowledge (maximum score = 52 points). Acceptance and knowledge scores were analyzed using the ANOVA and Tukey's tests. RESULTS: Of 192 physicians interviewed, most (60.4%) believed that herbal remedies were beneficial to health. Respondents had relatively high acceptance levels (mean = 5.69 +/- 0.29 points or 40% of total possible score) and poor knowledge (mean = 7.77 +/- 0.56 points or 15% of total possible score). Seventy-eight physicians (40.6%) admitted having used herbs in the past, and 60 of these (76.9%) were satisfied with the outcome. Although 52 physicians (27.1%) recommended the use of herbs to their patients only 29 (15.1%) were able to identify at least one known herb-drug interaction. CONCLUSION: The use of herbal remedies is relatively high in Trinidad, as throughout the world, and most patients self-medicate with or without the knowledge of their attending physician. Surprisingly, we demonstrated relatively high acceptance levels and use of herbs among physicians in Trinidad. This interesting scenario of high acceptance levels and poor knowledge creates a situation that demands urgent intervention. We recommend educational intervention to narrow the gap between acceptance and knowledge so that physicians would be adequately equipped to communicate with their patients on this modality. The integration of herbal medicine into the curriculum of medical schools, continuing education programs and the availability of reputable pharmacopoeias for referencing at public health institutions are useful instruments that can be used to close this gap and promote improved physician-patient communication. [Abstract/Link to Full Text]

Vas J, Perea-Milla E, Mendez C, Galante AH, Madrazo F, Medina I, Ortega C, Olmo V, Fernandez FP, Hernandez L, Seminario JM, Brioso M, Luna F, Gordo I, Godoy AM, Jimenez C, Ruiz MA, Montes J, Hidalgo A, Gonzalez-Quevedo R, Bosch P, Vazquez A, Lozano JV
Acupuncture and rehabilitation of the painful shoulder: study protocol of an ongoing multicentre randomised controlled clinical trial [ISRCTN28687220].
BMC Complement Altern Med. 2005;519.
BACKGROUND: Although the painful shoulder is one of the most common dysfunctions of the locomotor apparatus, and is frequently treated both at primary healthcare centres and by specialists, little evidence has been reported to support or refute the effectiveness of the treatments most commonly applied. According to the bibliography reviewed, physiotherapy, which is the most common action taken to alleviate this problem, has not yet been proven to be effective, because of the small size of sample groups and the lack of methodological rigor in the papers published on the subject. No reviews have been made to assess the effectiveness of acupuncture in treating this complaint, but in recent years controlled randomised studies have been made and these demonstrate an increasing use of acupuncture to treat pathologies of the soft tissues of the shoulder. In this study, we seek to evaluate the effectiveness of physiotherapy applied jointly with acupuncture, compared with physiotherapy applied with a TENS-placebo, in the treatment of painful shoulder caused by subacromial syndrome (rotator cuff tendinitis and subacromial bursitis). METHODS/DESIGN: Randomised controlled multicentre study with blind evaluation by an independent observer and blind, independent analysis. A study will be made of 465 patients referred to the rehabilitation services at participating healthcare centres, belonging to the regional public health systems of Andalusia and Murcia, these patients presenting symptoms of painful shoulder and a diagnosis of subacromial syndrome (rotator cuff tendinitis and subacromial bursitis). The patients will be randomised into two groups: 1) experimental (acupuncture + physiotherapy); 2) control (TENS-placebo + physiotherapy); the administration of rescue medication will also be allowed. The treatment period will have a duration of three weeks. The main result variable will be the change produced on Constant's Shoulder Function Assessment (SFA) Scale; as secondary variables, we will record the changes in diurnal pain intensity on a visual analogue scale (VAS), nocturnal pain intensity on the VAS, doses of non-steroid anti-inflammatory drugs (NSAIDs) taken during the study period, credibility scale for the treatment, degree of improvement perceived by the patient and degree of improvement perceived by the evaluator. A follow up examination will be made at 3, 6 and 12 months after the study period has ended. Two types of population will be considered for analysis: per protocol and per intention to treat. DISCUSSION: The discussion will take into account the limitations of the study, together with considerations such as the choice of a simple, safe method to treat this shoulder complaint, the choice of the control group, and the blinding of the patients, evaluators and those responsible for carrying out the final analysis. [Abstract/Link to Full Text]

Sagar L, Sehgal R, Ojha S
Evaluation of antimotility effect of Lantana camara L. var. acuelata constituents on neostigmine induced gastrointestinal transit in mice.
BMC Complement Altern Med. 2005;518.
BACKGROUND: Lantana camara L. (Verbenaceae), a widely growing shrub which is toxic to some animal species, has been used in the traditional medicine for treating many ailments. The purpose of the present study was to evaluate the antimotility effects of Lantana camara leaf constituents in mice intestine. METHODS: Evaluation of antimotility activity was done in intestine of mice treated with Lantana camara leaf powder, Lantana camara methanolic extract (LCME), lantadene A, neostigmine and neostigmine + LCME. Neostigmine was used as a promotility agent. Intestinal motility was assessed by charcoal meal test and gastrointestinal transit rate was expressed as the percentage of the distance traversed by the charcoal divided by the total length of the small intestine. The antidiarrheal effect of LCME was studied against castor oil induced diarrhea model in mice. RESULTS: The intestinal transit with LCME at a dose of 500 mg/kg was 26.46% whereas the higher dose (1 g/kg) completely inhibited the transit of charcoal in normal mice. The % intestinal transit in the neostigmine pretreated groups was 24 and 11 at the same doses respectively. When the plant extracts at 125 and 250 mg/kg doses were administered intraperitonealy, there was significant reduction in fecal output compared with castor oil treated mice. At higher doses (500 and 1000 mg/kg), the fecal output was almost completely stopped. CONCLUSION: The remarkable antimotility effect of Lantana camara methanolic extract against neostigmine as promotility agent points towards an anticholinergic effect due to Lantana camara constituents and attests to its possible utility in secretory and functional diarrheas and other gastrointestinal disorders. This effect was further confirmed by significant inhibition of castor oil induced diarrhea in mice by various doses of LCME. [Abstract/Link to Full Text]

Paula FB, Gouv�a CM, Alfredo PP, Salgado I
Protective action of a hexane crude extract of Pterodon emarginatus fruits against oxidative and nitrosative stress induced by acute exercise in rats.
BMC Complement Altern Med. 2005;517.
BACKGROUND: The aim of the present work was to evaluate the effect of a hexane crude extract (HCE) of Pterodon emarginatus on the oxidative and nitrosative stress induced in skeletal muscle, liver and brain of acutely exercised rats. METHODS: Adult male rats were subjected to acute exercise by standardized contractions of the tibialis anterior (TA) muscle (100 Hz, 15 min) and treated orally with the HCE (once or three times with a fixed dose of 498 mg/kg), before and after acute exercise. Serum creatine kinase activity was determined by a kinetic method and macrophage infiltration by histological analyses of TA muscle. Lipid peroxidation was measured as malondialdehyde (MDA) levels. Nitric oxide production was evaluated by measuring nitrite formation, using Griess reagent, and nitrotyrosine was assessed by western blotting. RESULTS: Serum creatine kinase activities in the controls (111 U/L) increased 1 h after acute exercise (443 U/L). Acute exercise also increased the infiltration of macrophages into TA muscle; lipid peroxidation levels in TA muscle (967%), liver (55.5%) and brain (108.9%), as well as the nitrite levels by 90.5%, 30.7% and 60%, respectively. The pattern of nitrotyrosine formation was also affected by acute exercise. Treatment with HCE decreased macrophage infiltration, lipid peroxidation, nitrite production and nitrotyrosine levels to control values. CONCLUSION: Acute exercise induced by functional electrical stimulation in rats resulted in increase in lipid peroxidation, nitrite and nitrotyrosine levels in brain, liver and skeletal muscle. The exercise protocol, that involved eccentric muscle contraction, also caused some muscle trauma, associated with over-exertion, leading to inflammation. The extract of P. emarginatus abolished most of these oxidative processes, thus confirming the high antioxidant activity of this oil which infusions are used in folk medicine against inflammatory processes. [Abstract/Link to Full Text]

Tajuddin S, Latif A, Qasmi IA, Amin KM
An experimental study of sexual function improving effect of Myristica fragrans Houtt. (nutmeg).
BMC Complement Altern Med. 2005;516.
BACKGROUND: Myristica fragrans Houtt. (nutmeg) has been mentioned in Unani medicine to be of value in the management of male sexual disorders. The present study was undertaken to evaluate the aphrodisiac effect of 50% ethanolic extract of nutmeg along with its likely adverse effects and acute toxicity using various animal models. METHODS: The suspension of the extract was administered (100, 250 and 500 mg/kg, p.o.) to different groups of male rats daily for seven days. The female rats involved in mating were made receptive by hormonal treatment. The general mating behaviour, libido and potency were studied and compared with the standard reference drug sildenafil citrate. Likely adverse effects and acute toxicity of the extract were also evaluated. RESULTS: Oral administration of the extract at the dose of 500 mg/kg, produced significant augmentation of sexual activity in male rats. It significantly increased the Mounting Frequency, Intromission Frequency, Intromission Latency and caused significant reduction in the Mounting Latency and Post Ejaculatory Interval. It also significantly increased Mounting Frequency with penile anaesthetization as well as Erections, Quick Flips, Long Flips and the aggregate of penile reflexes with penile stimulation. The extract was also observed to be devoid of any adverse effects and acute toxicity. CONCLUSION: The resultant significant and sustained increase in the sexual activity of normal male rats without any conspicuous adverse effects indicates that the 50% ethanolic extract of nutmeg possesses aphrodisiac activity, increasing both libido and potency, which might be attributed to its nervous stimulating property. The present study thus provides a scientific rationale for the traditional use of nutmeg in the management of male sexual disorders. [Abstract/Link to Full Text]

Smith C, Martin K, Hotham E, Semple S, Bloustien G, Rao D
Naturopaths practice behaviour: provision and access to information on complementary and alternative medicines.
BMC Complement Altern Med. 2005;515.
BACKGROUND: The increasing use of complementary and alternative medicines in Australia has generated concern regarding the information on these products available to both healthcare providers and the public. The aim of this study was to examine the practice behaviours of naturopaths in relation to both the provision of and access to information on complementary and alternative medicines (CAM). METHODS: A representative sample of 300 practicing naturopaths located nationally were sent a comprehensive survey which gathered data on self reported practice behaviour in relation to the provision of information on oral CAM to clients and the information needs of the practitioners themselves. RESULTS: A response rate of 35% was achieved. Most practitioners (98%) have a dispensary within their clinic and the majority of practitioners perform the dispensing themselves. Practitioners reported they provided information to clients, usually in the form of verbal information (96%), handwritten notes (83%) and printed information (75%). The majority of practitioners (over 75%) reported always giving information on the full name of the product, reason for prescribing, expected response, possible interactions and contraindications and actions of the product. Information resources most often used by practitioners included professional newsletters, seminars run by manufacturers, patient feedback and personal observation of patients. Most practitioners were positive about the information they could access but felt that more information was required in areas such as adverse reactions and safe use of CAM in children, pregnancy and breastfeeding. Most naturopaths (over 96%) were informed about adverse events through manufacturer or distributor newsletters. The barriers in the provision of information to clients were misleading or incorrect information in the media, time constraints, information overload and complex language used in printed information. The main barrier to the practitioner in information access was seen as the perceived division between orthodox and complementary medicine practitioners. CONCLUSION: Our data suggest most naturopaths were concerned about possible interaction between pharmaceuticals and CAM, and explore this area with their patients. There is scope to improve practitioners' access to information of adverse events including an increased awareness of sources of information such as the Australian Therapeutic Goods Administration (TGA) website. [Abstract/Link to Full Text]

Saravanan R, Pari L
Antihyperlipidemic and antiperoxidative effect of Diasulin, a polyherbal formulation in alloxan induced hyperglycemic rats.
BMC Complement Altern Med. 2005;514.
BACKGROUND: This study was undertaken to investigation the effect of Diasulin, a poly herbal drug composed of ethanolic extract of ten medicinal plants on blood glucose, plasma insulin, tissue lipid profile, and lipidperoxidation in alloxan induced diabetes. METHODS: Ethanolic extract of Diasulin a, poly herbal drug was administered orally (200 mg/kg body weight) for 30 days. The different doses of Diasulin on blood glucose and plasma insulin in diabetic rats were studied and the levels of lipid peroxides [TBARS, and hydroperoxide] and tissue lipids [cholesterol, triglyceride, phospholipides and free fatty acids] were also estimated in alloxan induced diabetic rats. The effects were compared with glibenclamide. RESULT: Treatment with Diasulin and glibenclamide resulted in a significant reduction of blood glucose and increase in plasma insulin. Diasulin also resulted in a significant decrease in tissue lipids and lipid peroxide formation. The effect produced by Diasulin was comparable with that of glibenclamide. CONCLUSION: The decreased lipid peroxides and tissue lipids clearly showed the antihyperlipidemic and antiperoxidative effect of Diasulin apart from its antidiabetic effect. [Abstract/Link to Full Text]

Recent Articles in Evidence-based Complementary and Alternative Medicine

Wahner-Roedler DL, Vincent A, Elkin PL, Loehrer LL, Cha SS, Bauer BA
Physicians' attitudes toward complementary and alternative medicine and their knowledge of specific therapies: a survey at an academic medical center.
Evid Based Complement Alternat Med. 2006 Dec;3(4):495-501.
The purpose of this study was to evaluate the attitudes of physicians at an academic medical center toward complementary and alternative medicine (CAM) therapies and the physicians' knowledge base regarding common CAM therapies. A link to a Web-based survey was e-mailed to 660 internists at Mayo Clinic in Rochester, MN, USA. Physicians were asked about their attitudes toward CAM in general and their knowledge regarding specific CAM therapies. The level of evidence a physician would require before incorporating such therapies into clinical care was also assessed. Of the 233 physicians responding to the survey, 76% had never referred a patient to a CAM practitioner. However, 44% stated that they would refer a patient if a CAM practitioner were available at their institution. Fifty-seven percent of physicians thought that incorporating CAM therapies would have a positive effect on patient satisfaction, and 48% believed that offering CAM would attract more patients. Most physicians agreed that some CAM therapies hold promise for the treatment of symptoms or diseases, but most of them were not comfortable in counseling their patients about most CAM treatments. Prospective, randomized controlled trials were considered the level of evidence required for most physicians to consider incorporating a CAM therapy into their practice. The results of this survey provide insight into the attitudes of physicians toward CAM at an academic medical center. This study highlights the need for educational interventions and the importance of providing physicians ready access to evidence-based information regarding CAM. [Abstract/Link to Full Text]

Ucler S, Coskun O, Inan LE, Kanatli Y
Cold Therapy in Migraine Patients: Open-label, Non-controlled, Pilot Study.
Evid Based Complement Alternat Med. 2006 Dec;3(4):489-93.
Some patients with headache report that they have frequently used physical therapies such as application of cold to relieve their headache. There are only a few reported studies related to cold therapies in patients with migraine. In this study, we investigated the effect of cold application on migraine patients. Twenty-eight migraine patients were included. Cold therapy was administered to them by gel cap. Patients used this cap during their two migraine attacks. Before and after the cold therapy, headache severity was recorded by using visual analogue scale (VAS). Patients used this cap for 25 min in each application. They recorded their VAS score just after the therapy and 25 min, 1 h, 2 h and 3 h later. Two patients could not use this therapy due to side effects (one due to cold intolerance and one due to vertigo) in both applications. Therefore, therapeutic efficacy was evaluated in 26 patients. Twenty-five minutes after treatment of the first attack, VAS score was decreased from 7.89 +/- 1.93 to 5.54 +/- 2.96 (P < 0.01). Twenty-five minutes after treatment of the second attack, VAS score was decreased from 7.7 +/- 1.8 to 5.4 +/- 3.55 (P < 0.01). Cold application alone may be effective in some patients suffering from migraine attacks. Its combination with conventional drugs should be investigated in future studies. [Abstract/Link to Full Text]

Grassberger M, Hoch W
Ichthyotherapy as alternative treatment for patients with psoriasis: a pilot study.
Evid Based Complement Alternat Med. 2006 Dec;3(4):483-8.
Ichthyotherapy (therapy with the so-called 'Doctorfish of Kangal', Garra rufa) has been shown to be effective in patients with psoriasis in the Kangal hot springs in Turkey. This study evaluates the efficacy and safety of ichthyotherapy in combination with short-term ultraviolet A sunbed radiation in the treatment of psoriasis under controlled conditions. We retrospectively analyzed 67 patients diagnosed with psoriasis who underwent 3 weeks of ichthyotherapy at an outpatient treatment facility in Lower Austria between 2002 and 2004. Main outcome measures are as follows: overall relative reduction in Psoriasis Area Severity Index (PASI) score; proportion of patients with an improvement in their PASI score of >/=75% (PASI-75) and >/=50% (PASI-50); patient-reported outcomes assessed with a custom questionnaire; and patient follow-up with a questionnaire sent out in March 2005. Safety was evaluated by reviewing adverse events and vital signs. Overall there was a 71.7% reduction in PASI score compared to baseline (P < 0.0001). Of the 67 patients studied, 31 (46.3%) achieved PASI-75 and 61 patients (91%) achieved at least PASI-50. Patients reported substantial satisfaction with the treatment. The reported mean remission period was 8.58 months [95% confidence interval (CI) 6.05-11.11]. A total of 87.5% of patients reported a more favorable outcome with ichthyotherapy, when asked to compare ichthyotherapy to other previously tried therapies. Sixty-five percent stated that after the relapse their symptoms were less severe than before treatment. There were no significant adverse events. The benefit demonstrated in this study along with the favorable safety profile suggests that ichthyotherapy could provide a viable treatment option for patients with psoriasis. [Abstract/Link to Full Text]

Ohnishi ST, Ohnishi T, Nishino K
Ki-energy (life-energy) protects isolated rat liver mitochondria from oxidative injury.
Evid Based Complement Alternat Med. 2006 Dec;3(4):475-82.
We investigated whether 'Ki-energy' (life-energy) has beneficial effects on mitochondria. The paradigm we developed was to keep isolated rat liver mitochondria in conditions in which they undergo heat deterioration (39 degrees C for 10 min). After the heat treatment, the respiration of the mitochondria was measured using a Clarke-type oxygen electrode. Then, the respiratory control ratio (RC ratio; the ratio between State-3 and State-4 respiration, which is known to represent the integrity and intactness of isolated mitochondria) was calculated. Without the heat treatment, the RC ratio was >5 for NADH-linked respiration (with glutamate plus malate as substrates). The RC ratio decreased to 1.86-4.36 by the incubation at 39 degrees C for 10 min. However, when Ki-energy was applied by a Japanese Ki-expert during the heat treatment, the ratio was improved to 2.24-5.23. We used five preparations from five different rats, and the significance of the differences of each experiment was either P < 0.05 or P < 0.01 (n = 3-5). We analyzed the degree of lipid peroxidation in the mitochondria by measuring the amount of TBARS (thiobarbituric acid reactive substances). The amount of TBARS in heat-treated, no Ki-exposed mitochondria was greater than that of the control (no heat-treated, no Ki-exposed). However, the amount was reduced in the heat-treated, Ki-exposed mitochondria (two experiments; both P < 0.05) suggesting that Ki-energy protected mitochondria from oxidative stress. Calcium ions may play an important role in the protection by Ki-energy. Data also suggest that the observed Ki-effect involves, at least, near-infrared radiation (0.8-2.7 mum) from the human body. [Abstract/Link to Full Text]

Ranjbar A, Khorami S, Safarabadi M, Shahmoradi A, Malekirad AA, Vakilian K, Mandegary A, Abdollahi M
Antioxidant Activity of Iranian Echium amoenum Fisch & C.A. Mey Flower Decoction in Humans: A cross-sectional Before/After Clinical Trial.
Evid Based Complement Alternat Med. 2006 Dec;3(4):469-73.
Medicinal plants are recognized as sources of natural antioxidants that can protect from biological system oxidative stress. The present cross-sectional before/after clinical trial was carried out to investigate the antioxidant properties of the decoction of the flowers of Echium amoenum Fisch & C.A. Mey in humans. A group of 38 healthy subjects was invited to use the E. amoenum (7 mg kg(-1)) twice daily for 14 days. Blood samples before and after entering the study were measured for lipid peroxidation level (LPO), total antioxidant capacity (TAC) and total thiol (SH) molecules. A significant reduction of blood LPO (24.65 +/- 11.3 versus 19.05 +/- 9.7, P = 0.029) was observed after 14 days of E. amoenum consumption. Blood TAC (1.46 +/- 0.51 versus 1.70 +/- 0.36, P = 0.018) and total thiol molecules (0.49 +/- 0.11 versus 0.56 +/- 0.12, P = 0.001) increased after 14 days of E. amoenum consumption. In conclusion, this antioxidative stress potential of E. amoenum may be due to its bioactive antioxidant components, especially rosmarinic acid and flavonoids. In recent years the importance of oxidative stress in the pathophysiology of many human disorders has been confirmed, thus use of this plant as a dietary supplement is highly recommended. [Abstract/Link to Full Text]

Kiyohara H, Nagai T, Munakata K, Nonaka K, Hanawa T, Kim SJ, Yamada H
Stimulating effect of Japanese herbal (kampo) medicine, hochuekkito on upper respiratory mucosal immune system.
Evid Based Complement Alternat Med. 2006 Dec;3(4):459-67.
Japanese herbal (Kampo) medicine, Hochuekkito (Bu-Zhong-Yi-Qi-Tang in Chinese, TJ-41) and Juzentaihoto (Shi-Quan-Da-Bu-Tang in Chinese, TJ-48) are well-known Kampo formulas used as tonic. Although these medicines have separately been applied to the patients clinically depending on their symptoms, the differences of the pharmacological activities for these medicines have not been fully understood. TJ-48 and TJ-41 were compared for their effects on antibody response in upper respiratory mucosal immune system in vivo. Oral administration of TJ-41 (100 mg kg(-1) per day) to early aged BALB/c mice, which were nasally sensitized with influenza hemagglutinin vaccine, significantly enhanced influenza virus-specific IgA and IgG antibody titers in nasal cavity and sera, respectively. However, oral administration of TJ-48 (100 mg kg(-1) per day) failed to show the enhancing activity. TJ-41 increased not only influenza virus-specific IgA antibody titer but also total IgA antibody titer in nasal cavity. The stimulating activity of TJ-41 disappeared after treatment with methotrexate. The present study strongly suggests that TJ-41 can stimulate the mucosal immune system of upper respiratory tract, and results in enhancement of antigen-specific antibody response in upper respiratory mucosal and systemic immune systems. [Abstract/Link to Full Text]

Chavan P, Joshi K, Patwardhan B
DNA microarrays in herbal drug research.
Evid Based Complement Alternat Med. 2006 Dec;3(4):447-57.
Natural products are gaining increased applications in drug discovery and development. Being chemically diverse they are able to modulate several targets simultaneously in a complex system. Analysis of gene expression becomes necessary for better understanding of molecular mechanisms. Conventional strategies for expression profiling are optimized for single gene analysis. DNA microarrays serve as suitable high throughput tool for simultaneous analysis of multiple genes. Major practical applicability of DNA microarrays remains in DNA mutation and polymorphism analysis. This review highlights applications of DNA microarrays in pharmacodynamics, pharmacogenomics, toxicogenomics and quality control of herbal drugs and extracts. [Abstract/Link to Full Text]

Dos Santos-Neto LL, de Vilhena Toledo MA, Medeiros-Souza P, de Souza GA
The use of herbal medicine in Alzheimer's disease-a systematic review.
Evid Based Complement Alternat Med. 2006 Dec;3(4):441-5.
The treatments of choice in Alzheimer's disease (AD) are cholinesterase inhibitors and NMDA-receptor antagonists, although doubts remain about the therapeutic effectiveness of these drugs. Herbal medicine products have been used in the treatment of Behavioral and Psychological Symptoms of Dementia (BPSD) but with various responses. The objective of this article was to review evidences from controlled studies in order to determine whether herbs can be useful in the treatment of cognitive disorders in the elderly. Randomized controlled studies assessing AD in individuals older than 65 years were identified through searches of MEDLINE, LILACS, Cochrane Library, dissertation Abstract (USA), ADEAR (Alzheimer's Disease Clinical Trials Database), National Research Register, Current Controlled trials, Centerwatch Trials Database and PsychINFO Journal Articles. The search combined the terms Alzheimer disease, dementia, cognition disorders, Herbal, Phytotherapy. The crossover results were evaluated by the Jadad's measurement scale. The systematic review identified two herbs and herbal formulations with therapeutic effects for the treatment of AD: Melissa officinalis, Salvia officinalis and Yi-Gan San and BDW (Ba Wei Di Huang Wan). Ginkgo biloba was identified in a meta-analysis study. All five herbs are useful for cognitive impairment of AD. M. officinalis and Yi-Gan San are also useful in agitation, for they have sedative effects. These herbs and formulations have demonstrated good therapeutic effectiveness but these results need to be compared with those of traditional drugs. Further large multicenter studies should be conducted in order to test the cost-effectiveness of these herbs for AD and the impact in the control of cognitive deterioration. [Abstract/Link to Full Text]

Saad B, Azaizeh H, Abu-Hijleh G, Said O
Safety of traditional arab herbal medicine.
Evid Based Complement Alternat Med. 2006 Dec;3(4):433-9.
Herbal remedies are widely used for the treatment and prevention of various diseases and often contain highly active pharmacological compounds. Many medicinal herbs and pharmaceutical drugs are therapeutic at one dose and toxic at another. Toxicity related to traditional medicines is becoming more widely recognized as these remedies become popular in the Mediterranean region as well as worldwide. Most reports concerning the toxic effects of herbal medicines are associated with hepatotoxicity although reports of other toxic effects including kidney, nervous system, blood, cardiovascular and dermatologic effects, mutagenicity and carcinogenicity have also been published in the medical literature. This article presents a systematic review on safety of traditional Arab medicine and the contribution of Arab scholars to toxicology. Use of modern cell biological, biochemical, in vitro and in vivo techniques for the evaluation of medicinal plants safety is also discussed. [Abstract/Link to Full Text]

Canter PH, Coon JT, Ernst E
Cost-effectiveness of complementary therapies in the United kingdom-a systematic review.
Evid Based Complement Alternat Med. 2006 Dec;3(4):425-32.
Objectives: The aim of this review is to systematically summarize and assess all prospective, controlled, cost-effectiveness studies of complementary therapies carried out in the UK. Data sources: Medline (via PubMed), Embase, CINAHL, Amed (Alternative and Allied Medicine Database, British Library Medical Information Centre), The Cochrane Library, National Health Service Economic Evaluation Database (via Cochrane) and Health Technology Assessments up to October 2005. Review methods: Articles describing prospective, controlled, cost-effectiveness studies of any type of complementary therapy for any medical condition carried out in the UK were included. Data extracted included the main outcomes for health benefit and cost. These data were extracted independently by two authors, described narratively and also presented as a table. Results: Six cost-effectiveness studies of complementary medicine in the UK were identified: four different types of spinal manipulation for back pain, one type of acupuncture for chronic headache and one type of acupuncture for chronic back pain. Four of the six studies compared the complementary therapy with usual conventional treatment in pragmatic, randomized clinical trials without sham or placebo arms. Main outcome measures of effectiveness favored the complementary therapies but in the case of spinal manipulation (four studies) and acupuncture (one study) for back pain, effect sizes were small and of uncertain clinical relevance. The same four studies included a cost-utility analyses in which the incremental cost per quality adjusted life year (QALY) was less than pound10 000. The complementary therapy represented an additional health care cost in five of the six studies. Conclusions: Prospective, controlled, cost-effectiveness studies of complementary therapies have been carried out in the UK only for spinal manipulation (four studies) and acupuncture (two studies). The limited data available indicate that the use of these therapies usually represents an additional cost to conventional treatment. Estimates of the incremental cost of achieving improvements in quality of life compare favorably with other treatments approved for use in the National Health Service. Because the specific efficacy of the complementary therapies for these indications remains uncertain, and the studies did not include sham controls, the estimates obtained may represent the cost-effectiveness non-specific effects associated with the complementary therapies. [Abstract/Link to Full Text]

Chiappelli F, Navarro AM, Moradi DR, Manfrini E, Prolo P
Evidence-Based Research in Complementary and Alternative Medicine III: Treatment of Patients with Alzheimer's Disease.
Evid Based Complement Alternat Med. 2006 Dec;3(4):411-24.
This paper presents the novel domain of evidence-based research (EBR) in the treatment of patients with Alzheimer's disease (AD) from the perspective of traditional medicine and of complementary and alternative medicine. In earlier lectures we have described the process of evidence-based medicine as a methodological approach to clinical practice that is directed to aid clinical decision-making. Here, we present a practical example of this approach with respect to traditional pharmacological interventions and to complementary and alternative treatments for patients with AD. [Abstract/Link to Full Text]

Bellavite P, Ortolani R, Pontarollo F, Piasere V, Benato G, Conforti A
Immunology and homeopathy. 4. Clinical studies-part 2.
Evid Based Complement Alternat Med. 2006 Dec;3(4):397-409.
The clinical studies on the effectiveness of homeopathy in respiratory allergy (18 randomized trials and 9 observational studies) are described. The literature of common immunologic disorders including also upper respiratory tract infections (URTI) and otorhinolaryngology (reported in part 1), is evaluated and discussed. Most of initial evidence-based research was addressed to the question of whether homeopathic high dilutions are placebos or possess specific effects, but this question has been often equivocal and is still a matter of debate. The evidence demonstrates that in some conditions homeopathy shows significant promise, e.g. Galphimia glauca (low dilutions/potencies) in allergic oculorhinitis, classical individualized homeopathy in otitis and possibly in asthma and allergic complaints, and a few low-potency homeopathic complexes in sinusitis and rhinoconjunctivitis. A general weakness of evidence derives from lack of independent confirmation of reported trials and from presence of conflicting results, as in case of homeopathic immunotherapy and of classical homeopathy for URTI. The suitable methods to evaluate homeopathy effectiveness, without altering the setting of cure, are also analyzed. [Abstract/Link to Full Text]

Cooper EL
eCAM: On To Year 4.
Evid Based Complement Alternat Med. 2006 Dec;3(4):395-6. [Abstract/Link to Full Text]

Caprilli S, Messeri A
Animal-Assisted Activity at A. Meyer Children's Hospital: A Pilot Study.
Evid Based Complement Alternat Med. 2006 Sep;3(3):379-83.
The authors systematically studied the introduction of animal-assisted activity into a children's hospital in Italy. This pilot study examined the reactions of children, their parents and the hospital staff and the hospital-wide infection rate before and after the introduction of animals. The SAM (self-assessment manikin), three behavioral scales, analysis of children's graphic productions, a parent questionnaire and a staff questionnaire were used to evaluate the effectiveness of the intervention. The children's participation was calculated. The analysis of the hospital infection rate was completed independently by the Hospital Infections Committee. The authors found that the presence of infections in the wards did not increase and the number of children at the meetings with pets in the wards was high (138 children). The study also found that the presence of animals produced some beneficial effects on children: a better perception of the environment and a good interaction with dogs. All parents were in favor of pets in the hospital, and 94% thought that this activity could benefit the child, as did the medical staff, although the staff needed more information about safety. The introduction of pets into the pediatric wards in an Italian children's hospital was a positive event because of the participation of hospitalized patients, the satisfaction expressed by both parents and medical staff, and the fact that the hospital infection rate did not change and no new infections developed after the introduction of dogs. [Abstract/Link to Full Text]

Williams TI
Evaluating effects of aromatherapy massage on sleep in children with autism: a pilot study.
Evid Based Complement Alternat Med. 2006 Sep;3(3):373-7.
Previous studies have found beneficial effects of aromatherapy massage for agitation in people with dementia, for pain relief and for poor sleep. Children with autism often have sleep difficulties, and it was thought that aromatherapy massage might enable more rapid sleep onset, less sleep disruption and longer sleep duration. Twelve children with autism and learning difficulties (2 girls and 10 boys aged between 12 years 2 months to 15 years 7 months) in a residential school participated in a within subjects repeated measures design: 3 nights when the children were given aromatherapy massage with lavender oil were compared with 14 nights when it was not given. The children were checked every 30 min throughout the night to determine the time taken for the children to settle to sleep, the number of awakenings and the sleep duration. One boy's data were not analyzed owing to lengthy absence. Repeated measures analysis revealed no differences in any of the sleep measures between the nights when the children were given aromatherapy massage and nights when the children were not given aromatherapy massage. The results suggest that the use of aromatherapy massage with lavender oil has no beneficial effect on the sleep patterns of children with autism attending a residential school. It is possible that there are greater effects in the home environment or with longer-term interventions. [Abstract/Link to Full Text]

Luo JZ, Luo L
American Ginseng Stimulates Insulin Production and Prevents Apoptosis through Regulation of Uncoupling Protein-2 in Cultured beta Cells.
Evid Based Complement Alternat Med. 2006 Sep;3(3):365-72.
American ginseng root displays the ability to achieve glucose homeostasis both experimentally and clinically but the unknown mechanism used by ginseng to achieve its therapeutic effects on diabetes limits its application. Disruption in the insulin secretion of pancreatic beta cells is considered the major cause of diabetes. A mitochondrial protein, uncoupling protein-2 (UCP-2) has been found to play a critical role in insulin synthesis and beta cell survival. Our preliminary studies found that the extracts of American ginseng inhibit UCP-2 expression which may contribute to the ability of ginseng protecting beta cell death and improving insulin synthesis. Therefore, we hypothesized that ginseng extracts suppress UCP-2 in the mitochondria of pancreatic beta cells, promoting insulin synthesis and anti-apoptosis (a programmed cell-death mechanism). To test the hypothesis, the serum-deprived quiescent beta cells were cultured with or without interleukin-1beta (IL-1beta), (200 pg ml(-1), a cytokine to induce beta cell apoptosis) and water extracts of American ginseng (25 mug per 5 mul administered to wells of 0.5 ml culture) for 24 h. We evaluated effects of ginseng on UCP-2 expression, insulin production, anti-/pro-apoptotic factors Bcl-2/caspase-9 expression and cellular ATP levels. We found that ginseng suppresses UCP-2, down-regulates caspase-9 while increasing ATP and insulin production/secretion and up-regulates Bcl-2, reducing apoptosis. These findings suggest that stimulation of insulin production and prevention of beta cell loss by American ginseng extracts can occur via the inhibition of mitochondrial UCP-2, resulting in increase in the ATP level and the anti-apoptotic factor Bcl-2, while down-regulation of pro-apoptotic factor caspase-9 occurs, lowering the occurrence of apoptosis, which support the hypothesis. [Abstract/Link to Full Text]

Nozaki K, Hikiami H, Goto H, Nakagawa T, Shibahara N, Shimada Y
Keishibukuryogan (gui-zhi-fu-ling-wan), a kampo formula, decreases disease activity and soluble vascular adhesion molecule-1 in patients with rheumatoid arthritis.
Evid Based Complement Alternat Med. 2006 Sep;3(3):359-64.
An increasing death rate due to cardiovascular disease in patients with rheumatoid arthritis (RA) has been reported. Keishibukuryogan (KBG) is a traditional Chinese/Japanese (Kampo) formula that has been administered to patients with blood stagnation, e.g. thrombotic disease and atherosclerosis. The objective of this study was to evaluate the efficacy of KBG on disease activity and endothelial dysfunction in RA patients. Sixteen RA patients were enrolled and administered KBG (12 g per day) for 12 weeks in addition to continuing other drugs. The disease activity of RA was assessed by modified disease activity scores for 28 joints (DAS(28)). Plasma levels of adhesion molecules, soluble E-selectin (sE-selectin), soluble intercellular adhesion molecule-1 (sICAM-1) and soluble vascular cell adhesion molecule-1 (sVCAM-1) were evaluated. C-reactive protein (CRP), inflammatory cytokines (IL-1beta, IL-6 and TNF-alpha) and lipid peroxide (LPO) were also evaluated. Fourteen patients completed the study. The disease activity of RA, tender joint count, swollen joint count and DAS(28) decreased significantly. Among adhesion molecules, only sVCAM-1 decreased significantly. LPO also decreased significantly, whereas CRP and inflammatory cytokines remained unchanged. These results suggest that KBG has insufficient anti-inflammatory or immunomodulating effect but does have a beneficial effect on articular symptoms and a protective effect against endothelial dysfunction in RA patients. [Abstract/Link to Full Text]

Mohandas Rao KG, Muddanna Rao S, Gurumadhva Rao S
Centella asiatica (L.) Leaf Extract Treatment During the Growth Spurt Period Enhances Hippocampal CA3 Neuronal Dendritic Arborization in Rats.
Evid Based Complement Alternat Med. 2006 Sep;3(3):349-57.
Centella asiatica (CeA) is a creeping plant growing in damp places in India and other Asian countries. The leaves of CeA are used for memory enhancement in the Ayurvedic system of medicine, an alternative system of medicine in India. In this study, we have investigated the effect during the rat growth spurt period of CeA fresh leaf extract treatment on the dendritic morphology of hippocampal CA3 neurons, one of the regions of the brain concerned with learning and memory. Neonatal rat pups (7 days old) were fed with 2, 4 or 6 ml kg(-1) body weight of fresh leaf extract of CeA for 2, 4 or 6 weeks. After the treatment period the rats were killed, their brains were removed and the hippocampal neurons were impregnated with silver nitrate (Golgi staining). Hippocampal CA3 neurons were traced using a camera lucida, and dendritic branching points (a measure of dendritic arborization) and intersections (a measure of dendritic length) were quantified. These data were compared with data for age-matched control rats. The results showed a significant increase in the dendritic length (intersections) and dendritic branching points along the length of both apical and basal dendrites in rats treated with 4 and 6 ml kg(-1) body weight per day of CeA for longer periods of time (i.e. 4 and 6 weeks). We conclude that the constituents/active principles present in CeA fresh leaf extract have a neuronal dendritic growth stimulating property; hence, the extract can be used for enhancing neuronal dendrites in stress and neurodegenerative and memory disorders. [Abstract/Link to Full Text]

Hidaka S, Okamoto Y, Uchiyama S, Nakatsuma A, Hashimoto K, Ohnishi ST, Yamaguchi M
Royal jelly prevents osteoporosis in rats: beneficial effects in ovariectomy model and in bone tissue culture model.
Evid Based Complement Alternat Med. 2006 Sep;3(3):339-48.
Royal jelly (RJ) has been used worldwide for many years as medical products, health foods and cosmetics. Since RJ contains testosterone and has steroid hormone-type activities, we hypothesized that it may have beneficial effects on osteoporosis. We used both an ovariectomized rat model and a tissue culture model. Rats were divided into eight groups as follows: sham-operated (Sham), ovariectomized (OVX), OVX given 0.5% (w/w) raw RJ, OVX given 2.0% (w/w) RJ, OVX given 0.5% (w/w) protease-treated RJ (pRJ), OVX given 2.0% (w/w) pRJ, OVX given 17beta-estradiol and OVX given its vehicle, respectively. The Ovariectomy decreased tibial bone mineral density (BMD) by 24%. Administration of 17beta-estradiol to OVX rats recovered the tibial BMD decrease by 100%. Administration of 2.0% (w/w) RJ and 0.5-2.0% (w/w) pRJ to OVX rats recovered it by 85% or more. These results indicate that both RJ and pRJ are almost as effective as 17beta-estradiol in preventing the development of bone loss induced by ovariectomy in rats. In tissue culture models, both RJ and pRJ increased calcium contents in femoral-diaphyseal and femoral-metaphyseal tissue cultures obtained from normal male rats. However, in a mouse marrow culture model, they neither inhibited the parathyroid hormone (PTH)-induced calcium loss nor affected the formation of osteoclast-like cells induced by PTH in mouse marrow culture system. Therefore, our results suggest that both RJ and pRJ may prevent osteoporosis by enhancing intestinal calcium absorption, but not by directly antagonizing the action of PTH. [Abstract/Link to Full Text]

Ljubuncic P, Dakwar S, Portnaya I, Cogan U, Azaizeh H, Bomzon A
Aqueous Extracts of Teucrium polium Possess Remarkable Antioxidant Activity In Vitro.
Evid Based Complement Alternat Med. 2006 Sep;3(3):329-38.
Teucrium polium L. (Lamiaceae) (RDC 1117) is a medicinal plant whose species have been used for over 2000 years in traditional medicine due to its diuretic, diaphoretic, tonic, antipyretic, antispasmodic and cholagogic properties. The therapeutic benefit of medicinal plants is often attributed to their antioxidant properties. We previously reported that an aqueous extract of the leaves and stems of this plant could inhibit iron-induced lipid peroxidation in rat liver homogenate at concentrations that were not toxic to cultured hepatic cells. Others have reported that organic extracts of the aerial components of this plant could inhibit oxidative processes. Against this background, we felt further investigation on the antioxidant action of the extract of T. polium prepared according to traditional Arab medicine was warranted. Accordingly, we assessed (i) its ability to inhibit (a) oxidation of beta-carotene, (b) 2,2'-azobis(2-amidinopropan) dihydrochloride (AAPH)-induced plasma oxidation and (c) iron-induced lipid peroxidation in rat liver homogenates; (ii) to scavenge the superoxide (O2*-) radical and the hydroxyl radical (OH(*)); (iii) its effects on the enzyme xanthine oxidase activity; (iv) its capacity to bind iron; and (v) its effect on cell glutathione (GSH) homeostasis in cultured Hep G2 cells. We found that the extract (i) inhibited (a) oxidation of beta-carotene, (b) AAPH-induced plasma oxidation (c) Fe(2+)-induced lipid peroxidation in rat liver homogenates (IC(50) = 7 +/- 2 mug ml(-1)); (ii) scavenged O2*-(IC(50) = 12 +/- 3 mug ml(-1)) and OH(*) (IC(50) = 66 +/- 20 mug ml(-1)); (iii) binds iron (IC(50) = 79 +/- 17 mug ml(-1)); and (iv) tended to increase intracellular GSH levels resulting in a decrease in the GSSG/GSH ratio. These results demonstrate that the extract prepared from the T. polium possesses antioxidant activity in vitro. Further investigations are needed to verify whether this antioxidant effect occurs in vivo. [Abstract/Link to Full Text]

Samane S, No�l J, Charrouf Z, Amarouch H, Haddad PS
Insulin-sensitizing and Anti-proliferative Effects of Argania spinosa Seed Extracts.
Evid Based Complement Alternat Med. 2006 Sep;3(3):317-27.
Argania spinosa is an evergreen tree endemic of southwestern Morocco. Many preparations have been used in traditional Moroccan medicine for centuries to treat several illnesses including diabetes. However, scientific evidence supporting these actions is lacking. Therefore, we prepared various extracts of the argan fruit, namely keel, cake and argan oil extracts, which we tested in the HTC hepatoma cell line for their potential to affect cellular insulin responses. Cell viability was measured by Trypan Blue exclusion and the response to insulin evaluated by the activation of the extracellular regulated kinase (ERK1/2), ERK kinase (MEK1/2) and protein kinase B (PKB/Akt) signaling components. None of the extracts demonstrated significant cytotoxic activity. Certain extracts demonstrated a bi-phasic effect on ERK1/2 activation; low doses of the extract slightly increased ERK1/2 activation in response to insulin, whereas higher doses completely abolished the response. In contrast, none of the extracts had any significant effect on MEK whereas only a cake saponin subfraction enhanced insulin-induced PKB/Akt activation. The specific action of argan oil extracts on ERK1/2 activation made us consider an anti-proliferative action. We have thus tested other transformed cell lines (HT-1080 and MSV-MDCK-INV cells) and found similar results. Inhibition of ERK1/2 activation was also associated with decreased DNA synthesis as evidenced by [(3)H]thymidine incorporation experiments. These results suggest that the products of Argania spinosa may provide a new therapeutic avenue against proliferative diseases. [Abstract/Link to Full Text]

Vojdani A, Erde J
Regulatory T Cells, a Potent Immunoregulatory Target for CAM Researchers: Modulating Tumor Immunity, Autoimmunity and Alloreactive Immunity (III).
Evid Based Complement Alternat Med. 2006 Sep;3(3):309-16.
Regulatory T (T(reg)) cells are the major arbiter of immune responses, mediating actions through the suppression of inflammatory and destructive immune reactions. Inappropriate T(reg) cell frequency or functionality potentiates the pathogenesis of myriad diseases with ranging magnitudes of severity. Lack of suppressive capability hinders restraint on immune responses involved in autoimmunity and alloreactivity, while excessive suppressive capacity effectively blocks processes necessary for tumor destruction. Although the etiology of dysfunctional T(reg) cell populations is under debate, the ramifications, and their mechanisms, are increasingly brought to light in the medical community. Methods that compensate for aberrant immune regulation may not address the underlying complications; however, they hold promise for the alleviation of debilitating immune system-related disorders. The dominant immunoregulatory nature of T(reg) cells, coupled with recent mechanistic knowledge of natural immunomodulatory compounds, highlights the importance of T(reg) cells to practitioners and researchers of complementary and alternative medicine (CAM). [Abstract/Link to Full Text]

Nigam Y, Bexfield A, Thomas S, Ratcliffe NA
Maggot Therapy: The Science and Implication for CAM Part II-Maggots Combat Infection.
Evid Based Complement Alternat Med. 2006 Sep;3(3):303-8.
Maggot therapy employs the use of freshly emerged, sterile larvae of the common green-bottle fly, Phaenicia (Lucilia) sericata, and is a form of artificially induced myiasis in a controlled clinical situation. Maggot therapy has the following three core beneficial effects on a wound: debridement, disinfection and enhanced healing. In part II of this review article, we discuss clinical infections and the evidence supporting the potent antibacterial action of maggot secretions. Enhancement of wound healing by maggots is discussed along with the future of this highly successful, often controversial, alternative treatment. [Abstract/Link to Full Text]

Bellavite P, Ortolani R, Pontarollo F, Piasere V, Benato G, Conforti A
Immunology and homeopathy. 4. Clinical studies-part 1.
Evid Based Complement Alternat Med. 2006 Sep;3(3):293-301.
The evidence-based research of the effectiveness of homeopathic medicines in common immunologic disorders is reviewed. In part 1, we introduce methodological issues of clinical research in homeopathy, and criteria utilized to evaluate the literature. Then 24 studies (12 randomized and 12 non-randomized) on common upper respiratory tract infections and otorhinolaryngologic complaints are described. In part 2, the focus will be on allergic diseases and the effectiveness of homeopathy will be globally evaluated and discussed using the criteria of evidence-based medicine. [Abstract/Link to Full Text]

Cooper EL
Regional Strength in CAM.
Evid Based Complement Alternat Med. 2006 Sep;3(3):291-2. [Abstract/Link to Full Text]

Lewith G, Verhoef M, Koithan M, Zick SM
Developing CAM Research Capacity for Complementary Medicine.
Evid Based Complement Alternat Med. 2006 Jun;3(2):283-9.
This article describes initiatives that have been central to the development of complementary and alternative medicine (CAM) research capacity in the United Kingdom, Canada and the United States over the last decade. While education and service delivery are essential parts of the development of CAM, this article will focus solely on the development of research strategy. The development of CAM research has been championed by both patients and politicians, primarily so that we may better understand the popularity and apparent effectiveness of these therapies and support integration of safe and effective CAM in health care. We hope that the perspective provided by this article will inform future research policy. [Abstract/Link to Full Text]

Stumpf SH, Shapiro SJ
Bilateral integrative medicine, obviously.
Evid Based Complement Alternat Med. 2006 Jun;3(2):279-82.
Unstated and unacknowledged bias has a profound impact on the nature and implementation of integrative education models. Integrative education is the process of training conventional biomedical and traditional Chinese medicine practitioners in each tradition such that patient care may be effectively coordinated. A bilateral education model ensures that students in each tradition are cross-taught by experts from the 'other' tradition, imparting knowledge and values in unison. Acculturation is foundational to bilateral integrative medical education and practice. Principles are discussed for an open-minded bilateral educational model that can result in a new generation of integrative medicine teachers. [Abstract/Link to Full Text]

Shmueli A, Shuval J
Satisfaction with Family Physicians and Specialists and the use of Complementary and Alternative Medicine in Israel.
Evid Based Complement Alternat Med. 2006 Jun;3(2):273-8.
Higher utilization of complementary and alternative medicine (CAM) is commonly explained by dissatisfaction or disappointment with conventional medical treatment. To explore, at two points in time in Israel, the associations between six domains of satisfaction (attitude, length of visits, availability, information sharing, perceived quality of care and overall) with conventional family physicians' and specialists' services and the likelihood of consulting CAM providers. This is a secondary analysis of interviews, which were conducted with 2000 persons in 1993 and 2500 persons in 2000, representing the Israeli Jewish urban population aged 45-75 in those years. Bivariate and multivariate analyses were used in the investigation. In 1993, users of CAM were less satisfied than non-users with both family physicians' and specialists' care. Lower satisfaction with the attitude of, the amount of information sharing by and in general with family physicians, and with the length of visits and perceived quality of care of specialists were significantly associated with CAM use. In 2000, lower satisfaction with specialists' attitude, length of visits, availability and in general was significantly related to the use of CAM. Lower satisfaction with family physicians and specialists is significantly associated with consulting CAM providers. However, with CAM becoming a mainstream medical care specialty in its own, lower satisfaction with conventional medicine specialists becomes the most important factor. [Abstract/Link to Full Text]

Jagetia GC, Rao SK
Evaluation of Cytotoxic Effects of Dichloromethane Extract of Guduchi (Tinospora cordifolia Miers ex Hook F & THOMS) on Cultured HeLa Cells.
Evid Based Complement Alternat Med. 2006 Jun;3(2):267-72.
Extracts of Tinospora cordifolia (TCE) have been shown to possess anti-tumor properties, but the mechanism of the anti-tumor function of TCE is poorly understood. This investigation elucidates the possible mechanism underlying the cytotoxic effects of dichlormethane extracts of TCE, after selecting optimal duration and concentration for treatment. HeLa cells were exposed to various concentrations of TCE, which has resulted in a concentration-dependent decline in the clonogenicity, glutathione-S-transferase (GST) activity and a concentration-dependent increase in lipid peroxidation (TBARS) with a peak at 4 h and lactate dehydrogenase (LDH) release with a peak at 2 h. Our results suggest that the cytotoxic effect of TCE may be due to lipid peroxidation and release of LDH and decline in GST. [Abstract/Link to Full Text]

Leite SP, Vieira JR, de Medeiros PL, Leite RM, de Menezes Lima VL, Xavier HS, de Oliveira Lima E
Antimicrobial Activity of Indigofera suffruticosa.
Evid Based Complement Alternat Med. 2006 Jun;3(2):261-5.
Various organic and aqueous extracts of leaves of Indigofera suffruticosa Mill (Fabaceae) obtained by infusion and maceration were screened for their antibacterial and antifungal activities. The extracts were tested against 5 different species of human pathogenic bacteria and 17 fungal strains by the agar-solid diffusion method. Most of the extracts were devoid of antifungal and antibacterial activities, except the aqueous extract of leaves of I. suffruticosa obtained by infusion, which showed strong inhibitory activity against the Gram-positive bacteria Staphylococcus aureus with a minimal inhibitory concentration (MIC) of 5000 microg ml(-1). The MIC values to dermatophyte strains were 2500 microg ml(-1) against Trichophyton rubrum (LM-09, LM-13) and Microsporum canis. This study suggests that aqueous extracts of leaves of I. suffruticosa obtained by infusion can be used in the treatment of skin diseases caused by dermatophytes. [Abstract/Link to Full Text]

Recent Articles in Journal of Negative Results in Biomedicine

No recent articles are currently available.

Recent Articles in The Canadian Journal of Clinical Pharmacology

Pereira JA, Holbrook AM, Dolovich L, Goldsmith C, Thabane L, Douketis JD, Crowther M, Bates SM, Ginsberg JS
Are brand-name and generic warfarin interchangeable? A survey of Ontario patients and physicians.
Can J Clin Pharmacol. 2005;12(3):e229-39.
BACKGROUND: The issue of therapeutic equivalence has been a source of controversy in Canada since the approval of generic warfarin products in 2000. OBJECTIVES: We surveyed Ontario patients and physicians on perceptions of generic warfarin and brand substitution. METHODS: Self-administered questionnaires employed 7.0-point Likert scales of agreement. Patient participants were drawn from a thromboembolism clinic in Hamilton, Ontario. Physician participants were from a random sample of 375 Ontario family physicians, internists, cardiologists and hematologists. RESULTS: Eighty-one patients responded: 52% female, mean age 63.4 years and 63% brand-name warfarin users. Overall, 33% of respondents agreed or strongly agreed that they would feel comfortable taking generic warfarin. However, seventeen percent agreed or strongly agreed that generic warfarin was neither as safe nor as effective as brand-name warfarin, with this view more common amongst patients taking brand-name than those taking generic warfarin. One hundred and ten (29.3%) physicians returned the survey--29% females, mean age 45.3 years, 22% family physicians. Forty-four percent agreed or strongly agreed that they would rather prescribe brand-name than generic warfarin for patients starting warfarin therapy, while 40.7% agreed or strongly agreed that they would not feel comfortable switching from brand-name to generic warfarin. However, only 19.4% of physicians who had switched patients from brand-name to generic warfarin actually reported difficulties in managing the switch. CONCLUSION: While most patients and physicians appear to have accepted the principle of therapeutic equivalence of generic and brand-name warfarin, a sizable minority has concerns that could influence prescribing and compliance. [Abstract/Link to Full Text]

Lau L, Baruchel S
Can Canada sustain paediatric phase I trials? A national survey of cancer relapse in children.
Can J Clin Pharmacol. 2005;12(3):e222-8.
BACKGROUND: Paediatric phase I trials are critical to the evaluation of new agents using standardized methodology. However a large proportion of paediatric patients in Canada do not have access to phase I therapy. OBJECTIVES: A National Paediatric Cancer Relapse Survey was conducted to collect preliminary data to evaluate the feasibility of multi-centre paediatric phase I trials within Canada. METHODS: A survey consisting of 20 individual questions was sent out to all of the 17 paediatric oncology centres in Canada. RESULTS: Fifteen centres (88%) responded to the survey. 1027 children are diagnosed with cancer each year in Canada while 241 present with recurrent cancer. Of the 85 patients who are considered to be eligible for phase I study each year, only 53% were referred for phase I therapy. Two centres have more than 10 eligible patients a year, while the remaining 13 centres have less than 10 eligible patients each year. CONCLUSIONS: We estimate that 20% of the eligible patients could be accrued to phase I trials and Canada may provide sufficient patient number, i.e. 25 to 30 solid tumour patients every 2 years, to allow one multi-centre paediatric phase I trial to be completed over a 2-year period. [Abstract/Link to Full Text]

Holroyd-Leduc JM, Liu BA, Maki BE, Zecevic A, Herrmann N, Black SE
The role of buspirone for the treatment of cerebellar ataxia in an older individual.
Can J Clin Pharmacol. 2005;12(3):e218-21.
BACKGROUND: Buspirone, a 5HT-agonist and D2-dopamine antagonist/agonist, has modest beneficial effects in younger individuals with cerebellar ataxia. However, it is unclear whether it is beneficial and tolerable in older ataxic individuals. OBJECTIVE: To determine if an older individual with cerebellar ataxia would benefit from and tolerate buspirone. METHODS: We performed a single-subject, double-blinded, placebo-controlled randomized-phase study. The 80 year-old subject was to undergo six 4-week testing periods, divided randomly into three treatment and three placebo arms with a 2-week washout period between each arm. Treatment consisted of buspirone hydrochloride. Outcomes were clinical gait and balance testing, posturography testing, and subjective measurement of balance confidence. RESULTS: There were no statistically significant objective improvements with buspirone. The subject experienced a subjective improvement in balance confidence and tolerated treatment. CONCLUSIONS: Single-subject studies can help when it is unclear whether drug trial results with young subjects are generalizable to an older subject. This single-subject study determined that buspirone was tolerable but not clearly beneficial for an ataxic older individual. [Abstract/Link to Full Text]

Koren G
How to increase your funding chances: common pitfalls in medical grant applications.
Can J Clin Pharmacol. 2005;12(2):e182-5.
This commentary identifies 16 items to consider when trying to achieve success with grant applications. [Abstract/Link to Full Text]

Lavoie F, Blais L, Castilloux AM, Scalera A, LeLorier J
Effectiveness and cost-effectiveness of antibiotic treatments for community acquired pneumonia (CAP) and acute exacerbations of chronic bronchitis (AECB).
Can J Clin Pharmacol. 2005;12(2):e212-7.
BACKGROUND: The antibacterial activity, tolerability profile and duration of treatment associated with antibiotics are important therapy attributes when considering treating patients for lower respiratory tract infections (LRTIs), such as community acquired pneumonia (CAP) and acute exacerbations of chronic bronchitis (AECB). OBJECTIVES: To investigate the effectiveness and cost-effectiveness of oral antibiotics used in the treatment of LRTIs. METHODS: A cohort of inhaled corticosteroids users who were diagnosed with a LRTI and dispensed a prescription for one of the antibiotics under study on the same day as the diagnosis was selected from the administrative health databases of the R�gie de l'assurance maladie du Qu�bec (RAMQ). The risks of treatment failure were estimated using a logistic regression analysis. Treatment failure was defined as another prescription for any antibiotic, an emergency room visit or hospitalization for LRTIs, or death, in the 20 days following the dispensation of the first antibiotic prescribed. A cost-minimization analysis was performed in which only the drug costs related to the first antibiotic filled were considered. RESULTS: A total of 3,610 episodes of LRTIs were studied. There were no significant differences between antibiotics in terms of their respective adjusted odds ratios for rates of failure. However, the lower cost associated with azithromycin was significantly different from the costs associated with any other antibiotic (p<0.0001). CONCLUSION: Clinical effectiveness appears to be similar amongst second line antibiotics that are commonly used in the treatment of LRTIs in the community. Using a cost-minimization analysis, azithromycin appears to be the most cost-effective antibiotic treatment in this setting. [Abstract/Link to Full Text]

Moride Y, Ducruet T, Boivin JF, Lavoie F, Rochon S
Utilization of non-steroidal anti-inflammatory drugs in Quebec: adherence to the Canadian consensus on prescription guidelines.
Can J Clin Pharmacol. 2005;12(2):e201-11.
BACKGROUND: Adverse events associated with the use of non-steroidal anti-inflammatory drugs (NSAIDs) have led to the publication of Canadian prescription guidelines. Prescription practices following the publication of these guidelines and the introduction of COX-2 inhibitors in the Quebec formulary of reimbursed medications remain largely unexplored. OBJECTIVES: To compare the prevalence of contra-indications and selected risk factors for NSAID-toxicity among COX-2 inhibitor users and non-selective NSAID users. METHODS: A case-control analysis was conducted in a random sample of Quebec adult drug plan members who were treated with celecoxib (n=42,422 cases), rofecoxib (n=25,674 cases), full-dose (anti-inflammatory doses) of non-selective NSAIDs (n=9,673 cases), or low-dose NSAIDs (n=2,745 controls) in the year 2000. Data were obtained from the Quebec prescription and medical services databases (RAMQ). RESULTS: Patients with a history of gastropathy were more likely to be prescribed COX-2 inhibitors than low-dose NSAIDs; the odds ratios were 1.73 (95%CI: 1.56-1.91) and 1.49 (1.33-1.66), respectively for celecoxib and rofecoxib. Corresponding results for concomitant use of anticoagulants were 1.95 (1.34-2.83) for celecoxib and 1.87 (1.26-2.77) for rofecoxib, and for use of corticosteroids they were 1.29 (1.08-1.54) and 1.23 (1.01-1.49). Conversely, patients with the following characteristics were less likely to receive COX-2 inhibitors than low-dose non-selective NSAIDs: age 75+ (OR=0.64; 0.56-0.72 for celecoxib, OR=0.48; 0.76-0.99 for rofecoxib), hypertension (OR=0.83; 0.75-0.92 for celecoxib, OR=0.87; 0.77-0.97 for rofecoxib), and concomitant use of diuretics (OR=0.72; 0.63-0.82 for celecoxib; OR=0.77; 0.66-0.89 for rofecoxib). CONCLUSION: Patients with risk factors for NSAID gastropathy were more likely prescribed COX-2 inhibitors, while the presence of other contra-indications led to the prescription of low-dose non-selective NSAIDs. However, 12.7% of users of full-dose non-selective NSAIDs were age 75+ and 12.0% had a history of gastropathy, which are considered important risk factors for adverse events. [Abstract/Link to Full Text]

Selby P, Kapur B, Hackman R, Koren G
No one asked the baby -- an ethical issue in placebo-controlled trials in pregnant smokers.
Can J Clin Pharmacol. 2005;12(2):e180-1.
This case report involving a placebo-controlled nicotine patch trial illustrates the difficult issue of conducting placebo studies in pregnancy, when one of the two patients involved cannot be asked to consent. [Abstract/Link to Full Text]

Sketris IS, Kephart G, Cooke CA, Skedgel CD, McLean-Veysey PR
Use of physician profiles to influence prescribing of topical corticosteroids.
Can J Clin Pharmacol. 2005;12(2):e186-97.
BACKGROUND: Physician profiling is a tool used to attempt to affect changes in prescribing. The Drug Evaluation Alliance of Nova Scotia (DEANS) decided to implement a physician profiling project to determine if prescribing of topical corticosteroids could be altered. OBJECTIVES: To evaluate a DEANS initiative utilizing physician prescribing profiles to shift prescribing of topical corticosteroids from higher to lower potency agents in beneficiaries of the Nova Scotia Seniors' Pharmacare Program. METHODS: Administrative claims from the Nova Scotia Seniors' Pharmacare program were used to identify prescriptions for topical corticosteroids. Prescriptions were summarized at the individual physician level, and aggregated by Anatomical Therapeutic Classification into weak, moderately potent, potent and very potent products. The number of prescriptions for topical corticosteroids was compared for the twelve-month period before and after mailing of the profiles. Overall results were aggregated by utilization and expenditures. RESULTS: The number of prescriptions for topical corticosteroids per physician profiled was 44.0 in 2000/2001 and 42.8 in 2001/2002 (p = NS) and the expenditures per physician profiled were 838.94 dollars in 2000/2001 and 826.81 dollars in 2001/2002 (p = NS). There was a small decrease in prescriptions dispensed for potent topical products over the profiling period (52.4% of prescriptions in 2000/2001 versus 51.5% of prescriptions in 2001/2002, p=0.03). Otherwise, changes in utilization or expenditures for topical corticosteroids were not statistically different between the profiling periods. CONCLUSIONS: This project showed that mailing unsolicited individual-level profiles did not alter prescribing or expenditures for topical corticosteroids over a two-year period. Further work is needed to determine physician attitudes towards such projects. [Abstract/Link to Full Text]

Zaidi AN
Anticonvulsant hypersensitivity syndrome leading to reversible myocarditis.
Can J Clin Pharmacol. 2005;12(1):e33-40.
A 67-year old Caucasian female was diagnosed with anticonvulsant hypersensitivity syndrome (AHS) after she developed the triad of high fevers, maculo-papular rash and internal organ involvement ten weeks after the institution of prophylactic phenytoin for resection of a meningioma. She developed congestive heart failure, with a substantial reduction in ejection fraction (EF) by an echocardiogram and serum cardiac enzyme elevation. In the setting of AHS, this was consistent with a drug-induced myocarditis. Treatment consisted of removal of the offending drug, diuretics and high dose steroids. Six weeks later her symptoms had completely resolved, with a return to a normal EF. [Abstract/Link to Full Text]

Ahn E, Kapur B, Koren G
Study on circadian variation in folate pharmacokinetics.
Can J Clin Pharmacol. 2005;12(1):e4-9.
BACKGROUND: In a new preparation of prenatal multivitamins, PregVit, two tablets a day (a.m. and p.m.) are given. Folic acid is separated from iron and zinc and is given in the p.m. tablet to overcome problems due to folic acid interactions with iron or zinc, and frequent presence of nausea and vomiting of pregnancy in the morning. The circadian variation of folate in humans has not been investigated. This is the first study attempting to determine whether circadian variation of folate pharmacokinetics exists in humans. OBJECTIVES: To determine whether circadian rhythm of folate pharmacokinetics exists in humans. METHODS: In a crossover design, six healthy, non-pregnant women were randomized to receive 1 tablet of PregVit p.m., containing 1.1 mg of folic acid, in the morning or evening. Serum folate levels were measured over 10 hours. The area under the concentration-time curve (AUC) was used to compare the extent of absorption between the two time periods. RESULTS: The mean AUC values for serum folate after administration of PregVit p.m. were 334.5+/-119.6 nM*h and 283.1+/-64.3 nM*h for morning and evening, respectively (P = 0.17). The morning and evening peak serum folate concentrations were also similar (135.3+/-41.7 nM and 130.3+/-14.2 nM, respectively) (P = 0.75). Similarly, the time to peak for the morning arm (1 0.5 hour) was similar to evening administration (1+/-0.4 hour). CONCLUSIONS: There is no evidence of circadian variation in folate pharmacokinetics. Thus, the introduction of folate in PregVit p.m. will not affect its effectiveness as compared to its routine administration in the morning. [Abstract/Link to Full Text]

Sitar DS
Old drugs - old people - new insights.
Can J Clin Pharmacol. 2005;12(1):e28-32.
Dr. Dan Sitar was the recipient of the 2004 CSCP Senior Investigator Award at the First Canadian Therapeutics Congress held in June 2004. He presented a lecture highlighting some of the studies he participated in that have contributed to an increased understanding of the role of aging on drug disposition and effect. [Abstract/Link to Full Text]

Gill SS, Bronskill SE, Mamdani M, Sykora K, Li P, Shulman KI, Anderson GM, Hillmer MP, Wodchis WP, Rochon PA
Representation of patients with dementia in clinical trials of donepezil.
Can J Clin Pharmacol. 2004;11(2):e274-85.
OBJECTIVES: To evaluate the representation of frail older adults in randomized controlled trials (RCTs), and to assess consequences of under representation by analyzing drug discontinuation rates. METHODS: A cohort of older adults newly dispensed donepezil in Ontario between September 2001 and March 2002 was constructed using administrative data. A systematic review of the literature identified RCTs of donepezil. Patients dispensed donepezil were then compared to clinical trial subjects. Discontinuation rates were examined for patients with and without potential contraindications to this drug. RESULTS: There were 6,424 older adults in the Ontario cohort with new claims for donepezil. Ten RCTs evaluating the use of donepezil were identified (n = 3,423). Between 51% and 78% of the Ontario cohort would have been ineligible for RCT enrollment. Patients dispensed donepezil were older (80.3 vs. 73.7 years, p < 0.001) and more likely to be in long-term care (14.1 vs. 7.1%, p < 0.001) than RCT subjects. Overall, 27.8% of the Ontario cohort discontinued donepezil within seven months of initial prescription. Discontinuation rates were significantly higher for patients with a history of obstructive lung disease, active cardiovascular disease, or Parkinsonism. CONCLUSIONS: Fewer than half of the older adults dispensed donepezil in Ontario would have been eligible to participate in the RCTs that established the efficacy of this drug. Discontinuation rates were higher among patient groups not represented in the trials. Clinicians should carefully assess the potential risks and benefits of such drug therapies for older patients with dementia. [Abstract/Link to Full Text]

Morgan SG, Yan L
Persistence with hypertension treatment among community-dwelling BC seniors.
Can J Clin Pharmacol. 2004;11(2):e267-73.
BACKGROUND: Previous research has documented low levels of persistence with prescribed hypertension treatment in Canada. With growing recognition of the value of appropriate drug therapy, rates of persistence may be improving over time. The purpose of this study was to examine persistence with prescribed hypertension treatment among newly treated community-dwelling seniors in British Columbia. METHODS: BC PharmaCare data was used to determine the cohort of seniors who were newly-treated hypertensives over the period 1993 to 2000. Medical and hospital claims from the BCLHD were searched for diagnoses indicating the presence of essential hypertension and potentially confounding conditions. Rates of persistence with drug therapy were analysed, accounting for patient, age, sex, clinical complexity, the existence of potentially confounding conditions, and type of drug first prescribed. RESULTS: For the period 1993 to 2000, 82,824 seniors were identified as new users of hypertension drugs with diagnosed essential hypertension. Fifty-one percent of these newly-treated hypertensives filled a contiguous series of hypertension prescriptions for at least one full year. There was a slight improvement in the rate of persistence over time (p<0.001). Evidence of specific co-morbidities that potentially complicate essential hypertension increased the likelihood of persistence among first-time users (p<0.001), whereas greater overall clinical complexity decreased the likelihood of persistence (p<0.001). Persistence was highest amongst patients initiated on newer anti-hypertensive drug therapies. CONCLUSIONS: Despite modest improvement, persistence with hypertension treatment among the elderly is very low. Further research into the reasons for non-persistence would be advanced through primary data collection, including survey-based research. New policies and practices are needed to encourage persistence with evidence-based therapies. [Abstract/Link to Full Text]

Rubin ET, Lee A, Ito S
When breastfeeding mothers need CNS-acting drugs.
Can J Clin Pharmacol. 2004;11(2):e257-66.
BACKGROUND: Breastfeeding is the ideal method of infant nutrition. However, if mothers need medications such as the central nervous system (CNS) acting drugs, infant safety concerns arise. Summarized information on infant exposure levels to drugs in milk and associated side effect profiles will help clinicians to rationalize and justify important drug therapy for a breastfeeding patient. METHODS: Electronic searches of MEDLINE and PsycINFO from 1966-2003, and of EMBASE from 1980-2003, were conducted for studies on breastfeeding or breast milk and medications in the following categories: antidepressants, antipsychotics, antiepileptics (or anticonvulsants) and anxiolytics. The infant exposure level (%) was defined as follows: [Drug concentration in milk (mg/mL)] x [Daily milk intake (mL/kg/d)] x 100 / Maternal dose (mg/kg/d). RESULTS: A total of 129 papers were eligible for analyses. Our findings indicate that the majority of the CNS-acting drugs, if taken by nursing women, result in average exposure levels to their breast-fed infants of less than 10% of the therapeutic doses per kg body weight. Exceptions are lithium, ethosuximide, phenobarbital, primidone, lamotrigine and topiramate. Adverse effect profiles do not always correlate with a higher exposure level. Overall, most reported adverse effect profiles appear benign. Where adverse effects were reported, they were often confounded by intrauterine exposure. CONCLUSIONS: CNS-acting drugs taken by the mother do not appear to pose any major risks of immediate adverse effects to the breastfeeding infant, although with most of the newer drugs further research is needed to be conclusive. [Abstract/Link to Full Text]

Shah BR, Mamdani M, Jaakkimainen L, Hux JE
Risk modification for diabetic patients. Are other risk factors treated as diligently as glycemia?
Can J Clin Pharmacol. 2004;11(2):e239-44.
BACKGROUND: The importance of glucose control is recognized both by patients with diabetes and their physicians. However, other preventative interventions, such as using medications to manage lipid and blood pressure levels, are underused for diabetic patients. OBJECTIVES: To determine whether patients with diligent glucose management are more likely to use medications that treat lipids and blood pressure. METHODS: Administrative data records were evaluated for all diabetic patients aged 65 or older residing in Ontario in 1999 without pre-existing coronary artery disease (n=161,553). Measures of diligent glucose management were insulin use and frequent capillary glucose testing ((3) 2 per day). Outcomes were prescription of a lipid-lowering drug or antihypertensive drug. Using multivariate modeling, odds ratios for each diligence measure were determined for each outcome, adjusting for age, sex, comorbidities, and other covariates. RESULTS: Patients using insulin did not have a clinically important difference in lipid-lowering drug use (adjusted odds ratio 0.9, 99% confidence interval 0.9 - 1.0, P=0.002) or antihypertensive drug use (adjusted odds ratio 1.1, 99% confidence interval 1.0 - 1.1, P<0.001) versus non-users. Adjusted odds ratios for frequent glucose testing were not significantly different from unity for either lipid-lowering or antihypertensive drug use. CONCLUSIONS: Patients who required and were capable of diligent glucose management, which is invasive, expensive and time-consuming, were no more likely to use medications to control lipids or blood pressure. Preventative care for patients with diabetes may be too focused on glycemic control, and may be neglecting the management of other cardiovascular risk factors. [Abstract/Link to Full Text]

C�t� I, Gr�goire JP, Moisan J, Chabot I
Quality of life in hypertension: the SF-12 compared to the SF-36.
Can J Clin Pharmacol. 2004;11(2):e232-8.
BACKGROUND: The SF-36 has frequently been used to measure health related quality of life (HRQOL) in hypertension. Recently, the SF-12, a shorter form of the SF-36, has been proposed. However, the validity of the SF-12 in hypertension has not yet been assessed. OBJECTIVES: To determine the extent to which the SF-12 provides similar measurements of HRQOL to those of the SF-36 in hypertensive individuals. METHODS: A study assessing the impact of a pharmacy-based intervention program on hypertensive individuals served as background for this study. One hundred and twelve individuals participated in this study. We compared the SF-36 with the SF-12 on item scores and summary measures using intraclass correlation coefficients (ICC), Pearson correlation coefficients and linear regression. RESULTS: The concordance between the SF-12 and the SF-36 on both physical (ICC=0.88) and mental (ICC=0.92) component summary scores (PCS and MCS respectively) is high and the relationship is linear and positive. Most of the variance in the SF-36 PCS (R2=0.78) and MCS (R2=0.85) can be explained by their SF-12 counterparts. The SF-12 PCS and MCS are the only significant predictor variables for the corresponding measure of the SF-36. CONCLUSIONS: The SF-12 appears to be a valid alternative to the SF-36 for clinical practice or research purposes when studying hypertensive individuals and their treatment. [Abstract/Link to Full Text]

Leonard B, Huff H, Merryweather B, Lim A, Mills E
Knowledge of safety and herb-drug interations amongst HIV+ individuals: a focus group study.
Can J Clin Pharmacol. 2004;11(2):e227-31.
OBJECTIVE: To determine how HIV+ individuals access safety and knowledge of drug interactions related to complementary and alternative medicine (CAM). METHODS: We conducted two separate focus group sessions with HIV+ users of complementary therapies. A total of 8 men participated at an urban health centre. Focus group sessions were audio taped and transcribed verbatim. Analysis was conducted independently and in duplicate, using thematic analysis. RESULTS: All focus group participants described their use of CAM as very important for their health maintenance, giving them a feeling of empowerment in their health care. Potential side effects and safety issues were indicated as major concerns for treatment decisions, but the participant's knowledge of safety issues involved in CAM care for HIV+ patients was limited. The sources used by the participants to gather information regarding safety and interactions with medications were varied but included: their CAM providers, their physicians, books, resources from AIDS Service Organizations, the internet and health food stores. Participants acknowledged that appraising the quality of such information is difficult. CONCLUSIONS: The participants in this study had a strong trust in CAM and used a wide variety of sources to gather information on CAM safety, though their knowledge base was poor. As the use of CAM grows, further research on how to disseminate reliable information on safety and efficacy to this potentially vulnerable population is required. [Abstract/Link to Full Text]

McIntyre RS, Mancini DA, Srinivasan J, McCann S, Konarski JZ, Kennedy SH
The antidepressant effects of risperidone and olanzapine in bipolar disorder.
Can J Clin Pharmacol. 2004;11(2):e218-26.
OBJECTIVE: To describe the antidepressant effectiveness of olanzapine and risperidone and compare their tolerability when employed adjunctively in bipolar I/II disorder. METHOD: In an observational study, twenty-one ambulatory subjects with DSM-IV defined bipolar I/II disorder, in any phase of the illness, openly received adjunctive risperidone or olanzapine. The primary efficacy parameters were the Hamilton Depression Rating Scale (HDRS-17) and the Maier and Philips Severity Subscale. Secondary efficacy parameters included the Young Mania Rating Scale (YMRS) along with the Clinical Global Impressions Scale (CGI). Response was defined as a significant change from baseline to endpoint in the total mean HDRS-17 score. The primary tolerability parameters were the Abnormal Involuntary Movement Scale (AIMS) along with changes in weight and body mass index (BMI-kg/m2). Patients were evaluated prospectively with repeated monthly assessments for up to 6 months. RESULTS: Eleven patients openly received risperidone; 10 received olanzapine adjunctive to either lithium or divalproex. Total mean HDRS-17 scores significantly decreased from baseline to endpoint in both groups (p=0.001), with the mean HDRS-17 total scores falling from 17(SD=3.2) to 5(SD=1.5) by 6 months in the risperidone-treated group and from 18 (SD=1.9) to 7 (SD=2.0) in the olanzapine-treated group. Differences between the risperidone-treated group and the olanzapine-treated group were not significant at 6 months (p=0.754). The mean doses of study medication were 2.88 (SD=1.6) mg/day for the risperidone-treated group and 12.69 (SD=2.3) mg/day for the olanzapine-treated group. Both risperidone and olanzapine were generally well tolerated. No patients developed tardive dyskinesia. Significant weight gain was experienced by patients in both groups [mean weight gain at endpoint was 5.9 kg in risperidone (p=0.023) and 11.3 kg in olanzapine (p=0.001)]. There was a significant difference in weight gain between the risperidone-treated group and the olanzapine-treated group (p=0.001). CONCLUSIONS: These pilot data, from the first prospective comparison study of risperidone and olanzapine in bipolar disorder, suggest that adjunctive administration of either agent may reduce depressive symptom severity. No subjects receiving risperidone or olanzapine developed tardive dyskinesia. Both compounds imparted substantial weight gain with significantly more weight gain accrual with olanzapine. As this was an observational study, the antidepressant effect and tolerability profile of these compounds requires validation via double-blind placebo controlled investigations. [Abstract/Link to Full Text]

Oh PI, Cohen EA, Mittmann N, Seung SJ
The economics of adjunctive therapies in coronary angioplasty: drugs, devices, or both?
Can J Clin Pharmacol. 2004;11(2):e202-11.
BACKGROUND: Abciximab reduces the number of ischemic events in patients undergoing angioplasty compared to standard therapy. Coronary stenting reduces the need for repeat procedures. Abciximab or stents individually are considered cost effective interventions. There is a need to quantify the economic value of the combination of abciximab and stenting over stenting alone. METHODS: A decision analytic model was developed incorporating the outcomes from the EPISTENT study. Costs from Canadian sources for hospitalization, procedures and medications were used. Life expectancy was estimated using a Markov model. Total expected costs and outcomes of the abciximab and stent vs. stent alone were compared in an incremental analysis. The perspective of the analysis was a Canadian teaching hospital. RESULTS: The acquisition cost for abciximab was partially offset by reduced costs for managing clinical events resulting in a net incremental cost of 1,076 dollars per patient over one year (8,617 dollars combination vs. 7,541 dollars stent alone). This added cost was accompanied by a reduction in large MI or death by an absolute rate of 5.7% at one year (5.3% combination vs. 11.0% stent alone), yielding an incremental cost-effectiveness ratio of 18,877 dollars per death or large MI averted. The long-term survival gain was 0.15 to 0.37 years yielding an attractive incremental cost effectiveness ratio of 2,832 dollars to 7,173 dollars per life year gained. CONCLUSIONS: The combination of abciximab and stenting versus stenting alone provides improved clinical outcomes at a very reasonable cost from the Canadian hospital perspective. [Abstract/Link to Full Text]

Gedevanishvili A, Chamoun A, Uretsky BF, Rahman AM
Acute coronary syndrome induced by intravenous ephedrine in pregnant woman with normal coronaries.
Can J Clin Pharmacol. 2004;11(2):e195-8.
Intravenous ephedrine administered during a C-section was observed to cause an acute coronary syndrome in a pregnant woman with normal coronaries. The patient developed sub-sternal chest pain, was noted to have 10 beats of non-sustained ventricular tachycardia, ST abnormalities were observed on her ECG and cardiac enzymes were elevated. The patient had normal coronary arteries by angiogram and during a one-year period of follow up no further cardiac events occurred. [Abstract/Link to Full Text]

Austin PC, Mamdani MM, Tu K
The impact of the Women's Health Initiative study on incident clonidine use in Ontario, Canada.
Can J Clin Pharmacol. 2004;11(2):e191-4.
BACKGROUND: Following publication of the Women's Health Initiative (WHI) study, many women discontinued use of estrogen replacement therapy. There is some evidence that the antihypertensive agent clonidine can reduce the frequency of hot flashes associated with menopause. OBJECTIVES: To determine the impact of the WHI study on incident use of clonidine in elderly women in Ontario, Canada. METHODS: Retrospective, population-based administrative database design. Data on all residents of Ontario over the age of 65 years were included. Time series methods were used to analyze change in incident clonidine use following publication of the WHI study. RESULTS: Following publication of the WHI study, incident use of clonidine increased substantially among elderly women in Ontario, Canada. Similar trends were not observed for incident use of other antihypertensive medications. CONCLUSION: During a period of time in which a large proportion of women discontinued estrogen replacement therapy, incident use of clonidine increased. There is some evidence that a small number of women may have sought alternative relief from menopausal symptoms using other pharmacological therapies. [Abstract/Link to Full Text]

Casciano R, Tarride JE, Breton MC, Stern L, Langer A
A pharmacoeconomic evaluation of the myocardial ischemia reduction with aggressive cholesterol lowering (MIRACL) study in Canada.
Can J Clin Pharmacol. 2004;11(1):e179-90.
OBJECTIVE: To determine a 16-week total healthcare cost and the cost-effectiveness of short-term, lipid-lowering therapy with atorvastatin 80 mg following acute coronary syndrome (ACS) in Canada. METHODS: The expected costs per patient on atorvastatin 80 mg per day and placebo were compared using clinical outcome data from the MIRACL study and cost data from the Ontario Case Costing Project and the Ontario Schedule of Benefits. The cost per event avoided was also assessed. The clinical outcomes measured included: death, cardiac arrest, non-fatal myocardial infarction (MI), fatal MI, angina pectoris, stroke, congestive heart failure, and surgical or percutaneous coronary revascularizations. All direct medical costs from the perspective of the Canadian health care system were taken into account. RESULTS: The total expected cost per patient was 2,590 dollars in the placebo group and 2,639 dollars in the atorvastatin group. The incremental cost of atorvastatin treatment (49.26 dollars per patient) corresponded to a cost of 1,285 dollars per event avoided. The cost savings obtained through the reduction in events offset 86% of the cost of atorvastatin treatment. Budget impact analysis revealed that increased rates of atorvastatin usage following ACS were associated with large numbers of events avoided at a small additional cost when projected to the Canadian population. CONCLUSIONS: In Canada, the clinical benefits of intensive short-term atorvastatin treatment administered within 96 hours after ACS were associated with a favorable cost-effectiveness ratio. The incremental cost of atorvastatin is mostly offset by savings due to the reduction in events in patients treated with atorvastatin. [Abstract/Link to Full Text]

Clemons M, Enright K, Cesta A, Charbonneau F, Chow E, Warr D, Kee-Cresswell D, Chang J, Yogendran G, Trudeau M, De Angelis C, Cottrell W, Dranitsaris G
Do physicians follow systemic treatment and funding policy guidelines?
Can J Clin Pharmacol. 2004;11(1):e168-78.
BACKGROUND: The use of bisphosphonates for the prevention of skeletal related events in women with bone metastases from breast cancer is well established. We undertook an evaluation of bisphosphonate use in clinical practice in three Canadian cancer centres. In addition we assessed whether or not physicians at these centres are following their local treatment guidelines and funding policies. METHODS: Charts and electronic files of patients who had received either clodronate or pamidronate at any time between January 2000 and December 2001 at three Canadian cancer centres were retrospectively reviewed. RESULTS: There has been a marked improvement in the time between the diagnosis of bone metastases and the commencement of bisphosphonates from a median of 155 days in 1998 to 24 days in 2001. However, despite a local funding policy requiring that oral clodronate be the first bisphosphonate used, this was the case in only 67% of patients. In addition, despite one centre's guidelines recommending that bisphosphonates be stopped once the patient was progressing, 90% of their patients remained on bisphosphonates until they died. CONCLUSIONS: A considerable amount of effort is spent on the creation of "evidence based" treatment guidelines. Funding agencies develop policies based on these treatment guidelines, but often funding is more restrictive than the treatment guideline would suggest. It is clear from this review that physicians still appear to manage a substantial proportion of patients outside of funding policies, but within evidence based recommendations. Therefore, a need exists for either the creation of guidelines and policies that physicians will follow or the implementation of methods to ensure that restrictive policies are actually followed. [Abstract/Link to Full Text]

Boucher M, Pharand C, Skidmore B
A critical appraisal of the CURE trial: role of clopidogrel in non-ST-segment elevation acute coronary syndromes.
Can J Clin Pharmacol. 2004;11(1):e156-67.
BACKGROUND: A clinical study, the CURE trial, compared the use of clopidogrel/acetylsalicylic acid (ASA) to ASA alone in 12,562 patients with non-ST-segment elevation acute coronary syndromes (ACS). Results of the trial suggested a possible first-line role for the more expensive combination of clopidogrel/ASA. OBJECTIVE: To perform a critical appraisal of the CURE trial, to determine the efficacy and safety of the clopidogrel/ASA combination in the management of ACS patients and to describe the population most likely to benefit from this combination. METHODS: A critical appraisal of the CURE trial was conducted. RESULTS: The CURE trial was found to be of high quality (Jadad score 5/5). An absolute risk reduction (ARR) of 2.1% was seen for the clopidogrel/ASA combination for the first primary outcome (death from cardiovascular causes, non-fatal myocardial infarction (MI), or stroke), compared to ASA alone. A 2.3% ARR was seen for the clopidogrel/ASA combination for the second primary outcome, which included the first primary outcome or refractory ischemia. The clinical benefit appears to have mainly been driven by a reduction in the risk of non-fatal MI. A 1% absolute risk increase (ARI) was observed for major bleeding in the clopidogrel/ASA group. Also, 5.2% of subjects in the clopidogrel/ASA group discontinued their study medication for adverse events other than bleeding, thrombocytopenia or allergy, compared to 3.5% in the ASA group. CONCLUSIONS: We established that the overall quality of the CURE trial was good. Compared to ASA, the clopidogrel/ASA combination reduces the risk of recurrent vascular ischemic events in non-ST elevation ACS patients. The main clinical benefit however appears to be limited to a reduction in the risk of non-fatal MI. This benefit needs to be interpreted in light of the associated increased bleeding risk. Given that the risk of MI is elevated in high-risk ACS patients, the benefit of clopidogrel/ASA combination is expected to outweigh the bleeding hazards for this population. As details of all adverse events were not reported, it was not possible to fully evaluate the safety of use of this intervention. [Abstract/Link to Full Text]

Ratnapalan S, Ito S
Pediatric resident education and needs assessment in clinical pharmacology.
Can J Clin Pharmacol. 2004;11(1):e150-5.
Objective: To identify perceived and unperceived educational needs of residents to organize a seminar series in clinical pharmacology. METHOD: All pediatric residents (48) and all attending general pediatric staff (20) were sent structured questionnaires with potential seminar topics. Data from previous pharmacy chart audits and complaints lodged with patient care representatives were analyzed as the environmental scans. RESULTS: There was a 75% response rate from both residents and staff. The responses were very similar and the only significant difference was the response to a seminar on correcting electrolyte imbalances which the residents favoured (p = 0.005). The environmental scans identified pain management as one of the main areas needing improvement. CONCLUSION: Perceived learning needs of residents are similar but not identical to those identified by the faculty. Environmental scanning can be used to identify unperceived learning needs. [Abstract/Link to Full Text]

Tett SE
A perspective on Australia's National Medicines Policy.
Can J Clin Pharmacol. 2004;11(1):e28-38.
There is international interest in Australia's health care system for prescription medicines. The issue is particularly topical in Canada with the debate following publication of the Romanow Report into the future of health care in Canada. This Report recommended a new National Drug Agency. Australia has a National Medicines Policy with four arms-quality, safety and efficacy of medicines; equity of access; a viable and responsible pharmaceutical industry; quality use of medicines. The four arms of the Policy are interlinked and interdependent for optimal functioning. In this paper, an overview of how the prescription drug system in Australia works is presented. The manuscript focuses upon specific aspects of the Policy, describing how it functions and some of the processes integral to success, from the viewpoint of the author. The discussion includes some of the advantages of Australia's system for pharmaceuticals as well as some of the problems, as these present opportunities for development and change. [Abstract/Link to Full Text]

Lee M, Pao D, Hsu T, Sonderskov A
Cost savings and effectiveness of outpatient treatment with low molecular weight heparin of deep vein thrombosis in a community hospital.
Can J Clin Pharmacol. 2004;11(1):e17-27.
This study was conducted at Centenary Health Centre of the Rouge Valley Health System, a community based hospital in Toronto. In January 1997, a new treatment was introduced for the management of patients with uncomplicated deep vein thrombosis (DVT). Eligible patients presenting at the ER were placed on LMWH (tinzaparin) and followed at home. Previously the patients had been hospitalized and treated with intravenous heparin until they reached a therapeutic international normalized ratio (INR). The intent of this study was to evaluate the patient outcomes and cost-savings of the new approach. METHODS: Data from all patients eligible for home care, treated in 1996 were assembled and compared with those from all eligible patients treated from April 1, 1997 to March 31, 1998. The data was collected by chart review and consisted of patient outcomes and costs during the period of heparin treatment. Costs for hospitalized patients were based on a per diem. For home care patients, the costs were itemized according to service and medication usage. All costs were calculated in 1999 Canadian dollars. RESULTS: In each one year period, 39 cases were treated. There was no serious adversity and the outcomes were compatible with what has been reported in the literature. The mean cost per patient for the 1996 hospitalized cohort was $3,266 compared to $584 for the subsequent home care cohort. The difference was statistically significant (p<0.00001). CONCLUSION: Home care with tinzaparin compared to hospital care with IV heparin resulted in a large mean saving per patient with no difference in outcome. [Abstract/Link to Full Text]

Ong D, Popat A, Knowles SR, Arrowood JS, Shear NH, Binkley KE
Objective psychological measurement and clinical assessment of anxiety in adverse drug reactions.
Can J Clin Pharmacol. 2004;11(1):e8-16.
BACKGROUND: A confounding factor in the diagnosis of adverse drug reactions (ADRs) is the psychological state of the patient. Patients with underlying anxiety and related disorders may present with psychogenic reactions, which involve physiologic responses originating from psychological, rather than organic factors. OBJECTIVE: To examine the contribution of anxiety and related disorders to adverse drug events. METHODS: Participants from an adverse drug reaction clinic completed the Trauma Symptom Checklist-40 (TSC-40), a 40-item questionnaire consisting of six subscales: anxiety, depression, dissociation, sexual abuse trauma index (SATI), sexual problems, and sleep disturbance. Physicians assessed the likelihood that adverse events were due to anxiety or drug(s) by providing an anxiety score (0 to 10) and an ADR score (0 to 10), respectively, for each participant. RESULTS: Patients clinically assessed as having "high anxiety" (anxiety score 7-10 and ADR score 0-3; n = 11) scored higher than patients clinically assessed as having a "true ADR" (anxiety score 0-3 and ADR score 7-10; n = 19) on the TSC-40 total (P = 0.006) as well as anxiety (P = 0.012), depression (P = 0.007), and SATI subscales (P = 0.016). CONCLUSION: This study is the first to use a validated psychological measurement to indicate that a substantial percentage of reported adverse drug events may in fact be a manifestation of underlying anxiety and/or related disorders. We suggest that mechanisms of symptom generation may be analogous to those operative in idiopathic environmental intolerance. [Abstract/Link to Full Text]

Ipp M, Taddio A, Goldbach M, Ben David S, Stevens B, Koren G
Effects of age, gender and holding on pain response during infant immunization.
Can J Clin Pharmacol. 2004;11(1):e2-7.
Determinants of infant pain responses are important when assessing the efficacy of analgesics. In a randomized controlled trial, 106 infants aged 2 to 6 months were positioned either supine (SUP) on the examination table or held (HLD) by a parent during routine immunization in a community pediatric office. There was no difference between the SUP and HLD infants in duration of crying, facial grimacing or visual analogue scale (VAS) pain scores. Similarly gender did not affect pain response. In contrast, 2-month-old infants displayed more pain during immunization than did 4 or 6-month-old infants. [Abstract/Link to Full Text]

Recent Articles in Journal of Pharmacy & Pharmaceutical Sciences

Nachtigal P, Jamborova G, Pospisilova N, Pospechova K, Solichova D, Zdansky P, Semecky V
Atorvastatin has distinct effects on endothelial markers in different mouse models of atherosclerosis.
J Pharm Pharm Sci. 2006;9(2):222-30.
PURPOSE: Atherosclerosis is a progressive process that initially involves endothelial dysfunction. We investigated the effects of atorvastatin on both lipid parameters, and VCAM-1 and ICAM-1 expression in apoE-deficient or wild type C57BL/6J mice. METHODS:The C57BL/6J mice were fed with either chow or an atherogenic diet for 12 weeks. Male apoE-deficient mice were fed with the chow diet for 12 weeks. In 3 atorvastatin treated groups mice were fed the same diet as described above except atorvastatin was added to the diet at the dosage of 10 mg/kg per day for the last 8 weeks before euthanasia. RESULTS: Biochemical analysis showed that atorvastatin significantly decreased total cholesterol levels and VLDL in C57BL/6J mice fed with atherogenic diet but increased serum lipid levels in apoE-deficient mice. Stereological analysis of the immunohistochemical staining revealed that atorvastatin reduced endothelial expression of ICAM-1 and VCAM-1 only in C57BL/6J mice on chow diet. CONCLUSION: We have demonstrated that endothelial expression of both VCAM-1 and ICAM-1 does not correlate with cholesterol levels in these mice. Moreover, we showed that 8-week administration of atorvastatin decrease endothelial expression of VCAM-1 and ICAM-1 in C57BL/6J wild type mice beyond its lipid lowering effect but not in C57BL/6J wild type mice fed by atherogenic diet or in apoE-deficient mice. [Abstract/Link to Full Text]

Guangli M, Yiyu C
Predicting Caco-2 permeability using support vector machine and chemistry development kit.
J Pharm Pharm Sci. 2006;9(2):210-21.
PURPOSE: To predict Caco-2 permeability is a valuable target for pharmaceutical research. Most of the Caco-2 prediction models are based on commercial or special software which limited their practical value. This study represents the relationship between Caco-2 permeability and molecular descriptors totally based on open source software. METHODS:The Caco-2 prediction model was constructed based on descriptors generated by open source software Chemistry Development Kit (CDK) and a support vector machine (SVM) method. Number of H-bond donors and three molecular surface area descriptors constructed the prediction model. RESULTS:The correlation coefficients (r) of the experimental and predicted Caco-2 apparent permeability for the training set and the test set were 0.88 and 0.85, respectively. CONCLUSION: The results suggest that the SVM method is effective for predicting Caco-2 permeability. Membrane permeability of compounds is determined by number of H-bond donors and molecular surface area properties. [Abstract/Link to Full Text]

de F Navarro Schmidt D, Yunes RA, Schaab EH, Malheiros A, Cechinel Filho V, Franchi GC, Nowill AE, Cardoso AA, Yunes JA
Evaluation of the anti-proliferative effect the extracts of Allamanda blanchetti and A. schottii on the growth of leukemic and endothelial cells.
J Pharm Pharm Sci. 2006;9(2):200-8.
PURPOSE: To investigate the anti-proliferative effect of A. blanchetti and A. schottii extracts. METHODS: The anti-proliferative effect of A. blanchetti and A. schottii ethanolic extracts on K562 leukemic cells as well as on BMEC and HUVEC were evaluated. Phytochemical analysis to identify the possible active components was carried out. RESULTS: The root extract of A. schottii was the most active of them. At 80 microg/mL, the root extracts showed a cytostatic effect on K562, whereas at 400 microg/mL, there was a strong cytotoxic effect. Similar cytostatic and cytotoxic effects were seen in the endothelial cells, but at lower doses. The effect of A. schottii root extract on endothelial cells was seen at concentrations ten times lower (8 microg/mL) than the effect of the A. blanchetti root extract (80 microg/mL). Phytochemical investigation of different fractions and parts of the plant led to the isolation of several known compounds, some of which are described for the first time in the genus Allamanda, and with previous evidence of anticancer and antitumoral properties. CONCLUSIONS: Our results suggest that both plants studied exhibit cytostatic and cytotoxic activity, but the most active compounds are located in the roots. [Abstract/Link to Full Text]

Yang JJ, Zheng J, Liu HJ, Liu YX, Shen JC, Zhou ZQ
Epinephrine infiltration on nasal field causes significant hemodynamic changes: hypotension episode monitored by impedance-cardiography under general anesthesia.
J Pharm Pharm Sci. 2006;9(2):190-7.
PURPOSE: Local infiltration of epinephrine-containing local anesthetics is widely used in clinics particularly in the procedure of surgeries on vascularity field to provide good analgesia and hemostasis. A prospective randomized double blind control study was designed to observe hemodynamic changes caused by local infiltration of epinephrine- containing lidocaine solution on nasal field under general anesthesia. METHODS: 90 adult patients undergoing elective functional endoscopic sinus surgery under general anesthesia were randomly allocated into three groups and received 1% lidocaine 4 mL with different dose of epinephrine (group I 20 microg; group II 40 microg; and group III 0 microg) respectively. Mean arterial pressure (MAP), heart rate (HR), cardiac index (CI), systemic vascular resistance index (SVRI), and acceleration index (ACI) were recorded through impedance-cardiography at every 45 seconds in 6 minutes after the beginning of local infiltration. RESULTS:Compared with the intra-group baseline, statistically significant hemodynamic changes particularly decrease in MAP with increase in HR at 1.5 minutes time point (P < 0.01), and decrease in SVRI and increase in CI, ACI at and from 1.5 minutes time point (P > 0.05) were observed in group I and group II, but not in group III. CONCLUSION: Local infiltration of epinephrine-containing lidocaine solution on nasal field causes significant decrease in MAP and SVRI, and increase in HR, CI and ACI. [Abstract/Link to Full Text]

Emami J
In vitro - in vivo correlation: from theory to applications.
J Pharm Pharm Sci. 2006;9(2):169-89.
A key goal in pharmaceutical development of dosage forms is a good understanding of the in vitro and in vivo performance of the dosage forms. One of the challenges of biopharmaceutics research is correlating in vitro drug release information of various drug formulations to the in vivo drug profiles (IVIVC). Thus the need for a tool to reliably correlate in vitro and in vivo drug release data has exceedingly increased. Such a tool shortens the drug development period, economizes the resources and leads to improved product quality. Increased activity in developing IVIVCs indicates the value of IVIVCs to the pharmaceutical industry. IVIVC can be used in the development of new pharmaceuticals to reduce the number of human studies during the formulation development as the main objective of an IVIVC is to serve as a surrogate for in vivo bioavailability and to support biowaivers. It supports and/or validates the use of dissolution methods and specification settings. This is because the IVIVC includes in vivo relevance to in vitro dissolution specifications. It can also assist in quality control for certain scale-up and post-approval changes (SUPAC). With the proliferation of modified-release products, it becomes necessary to examine the concept of IVIVC in greater depth. Investigations of IVIVC are increasingly becoming an integral part of extended release drug development. There must be some in vitro means of assuring that each batch of the same product will perform identically in vivo. This review article represents the FDA guidance, development, evaluation, and validation of an IVIVC to grant biowaivers, and to set dissolution specifications for oral dosage forms, biopharmaceutics classification systems (BCS), BCS biowaivers, application of BCS in IVIVC development and concept of mapping. The importance of dissolution media and methodology and pharmacokinetic studies in the context of IVIVC has been highlighted. The review also covers the literature examples of IVIVCs regarding internal and external validation, compendial dissolution assessment, formulation dependency of IVIVCs, and IVIVCs of pure enantiomers versus racemate drugs. The same principles of IVIVC used for oral extended release products may be applied for non-oral products such as parenteral depot formulations and novel drug delivery systems as well. [Abstract/Link to Full Text]

Shahhosseini S, Guttikonda S, Bhatnagar P, Suresh MR
Production and characterization of monoclonal antibodies against shope fibroma virus superoxide dismutase and glutathione-s-transferase.
J Pharm Pharm Sci. 2006;9(2):165-8.
PURPOSE: The superoxide dismutase (SOD) like proteins encoded by Leporipoxviruses play a role in regulating the redox status of infected cells. The biological function of these proteins is unclear. Why poxviruses encode these proteins are still unknown. Exploiting standard hybridoma techniques, we developed a monoclonal antibody (MAb) against shope fibroma virus superoxide dismutase (sfvSOD) to be used in diagnostics and as tools to understand the role of SOD-like proteins in pathogenesis. METHODS: Hybridoma cell fusion technology was used for production of MAbs. Balb/c mice were immunized with sfvSOD-GST fusion protein. Hybridoma clones were screened using indirect enzyme linked immunosorbent assay (ELISA). Specificity and reactivity of the MAbs were determined by Western blot analysis (WBA) and indirect ELISA. Protein G affinity chromatography was used for the purification of MAbs. RESULTS: Two stable hybridoma clones producing MAbs against the two domains of the fusion protein were obtained. The anti-GST (glutathione-s-transferase) and anti-sfvSOD MAbs were found to react specifically with GST and sfvSOD proteins respectively, in addition to the sfvSOD-GST fusion protein. Isotypes of these MAbs were identified as IgG2b heavy chain and k light chain.CONCLUSION: The anti-sfvSOD MAb (P115.SOD MAb) has been successfully used in studying the enzymatic and biochemical properties of a SOD homolog encoded by sfv. We also developed a strong anti-GST MAb which was also cloned and characterized P115.GST MAb. The anti-GST MAb might be useful in analyzing GST fusion proteins and in immunoaffinity chromatography purification of GST fusion proteins. [Abstract/Link to Full Text]

Molavi O, Shayeganpour A, Somayaji V, Hamdy S, Brocks DR, Lavasanifar A, Kwon GS, Samuel J
Development of a sensitive and specific liquid chromatography/mass spectrometry method for the quantification of cucurbitacin I (JSI-124) in rat plasma.
J Pharm Pharm Sci. 2006;9(2):158-64.
PURPOSE: To develop a liquid chromatography/mass spectrometry (LC-MS) method for the quantitative analysis of cucurbitacin I (JSI-124), an anti-cancer inhibitor of the janus kinase 2/signal transducer and activator of transcription 3 (JAK2/STAT3) signaling pathway, in rat plasma samples. METHODS: Standard samples of cucurbitacin I were prepared from a stock solution (1 mg/mL) in methanol. Internal standard (I.S.) was 4-hydroxybenzophenone. Extraction of cucurbitacin I and I.S. from rat plasma was performed using acetonitrile/dichloromethane. LC-MS analyses were performed using a Waters Micromass ZQ 4000 spectrometer, and chromatographic separation was achieved using a Waters XTerraMSC18 3.5 microm (2.1 x 50 mm) column as the stationary phase. The mobile phase consisting of a mixture of acetonitrile: water containing 1% formic acid with initial ratio of 20:80, employing a linear gradient to a final ratio of 40:60 v/v over 13 minutes, was delivered at a constant flow rate of 0.2 mL/min. The mass spectrometer was operated in negative ionization mode and analytes were quantified with single ion recording (SIR) at m/z 559 for cucurbitacin I and m/z 196.8 for I.S. RESULTS: Calibration curves with r2 > 0.999 were constructed over the concentration range of 5-10000 ng/mL for the solution of cucurbitacin I in methanol and 10-1000 ng/mL for rat plasma samples. The extraction recoveries were 86 and 98% for 50 ng/mL and 1000 ng/mL plasma concentration of cucurbitacin I, respectively. The intra- and inter-day coefficients of variation were less than 15%, and mean intraday errors were less than 10% at plasma concentration extending from 10-1000 ng/mL. CONCLUSION: The developed assay is sensitive, specific, reproducible and reliable for quantitative analysis of cucurbitacin I. Application in a pharmacokinetic assessment was proven in the rats given the drug. [Abstract/Link to Full Text]

Awad A, Al-Ebrahim S, Abahussain E
Pharmaceutical care services in hospitals of Kuwait.
J Pharm Pharm Sci. 2006;9(2):149-57.
PURPOSE: To describe the current pharmacy practice in the general public hospitals based on self-reported practice by pharmacists, explore the awareness of the pharmacists of pharmaceutical care concept, identify their willingness to implement pharmaceutical care practice, and identify the barriers that may limit its implementation. METHODS: Eighty hospital pharmacists working in four general public hospitals were approached to be included in the study. Data were colleted via face-to-face structured interview of the respondents using a pre-tested questionnaire. RESULTS: The response rate was 76.3%. Thirty five (57.4%) of the respondents had frequently performed interventions on prescriptions through interaction with physicians. Thirty two (52.5%) had frequently provided patient counselling. The knowledge of the respondents about the counseling points for salbutamol inhaler was assessed using a total score of 10, 35 (57.4%) scored = 5. The frequent provision of counseling was non-significantly least common among the > 40 years group compared to youngest age group (OR: 0.7, 0.3-1.9), male gender (0.6, 0.2-1.4) and those with a practice experience of > 20 years (0.4, 0.1-1.2). Forty six (75.4%) of the respondents reported that they were aware of pharmaceutical care concept. Thirty five (76.1%) and 39.1% of those who reported awareness of pharmaceutical care concept indicated that its main focus is the patient and the appropriate objectives of the concept, respectively. The awareness about the patient as the main focus of pharmaceutical care was non-significantly least among the respondents aged 41-60 years (OR: 0.6, 0.2-2.4) and those with a practice experience of 21-40 years (0.3, 0.1-1.0). The main barriers perceived by the participants were lack of time (78%) and lack of staff (71.2%). CONCLUSION: The current practice of hospital pharmacists in Kuwait needs further improvement in relation to interaction with physicians and patient counselling. The lack of uniformity in the responses regarding the focus and objectives of pharmaceutical care indicates a lack of appropriate understanding in this matter. All respondents have shown high willingness towards the implementation of pharmaceutical care services in their practice. [Abstract/Link to Full Text]

Peng YW, Chi L, Gibson G, Janiczek N, Juneau P, Ross D, A Perrin L, Leadley R
Formulation modifications of PD 0313052, a direct Factor Xa Inhibitor, alter pharmacokinetics and pharma-codynamics following subcutaneous administration to rabbits.
J Pharm Pharm Sci. 2006;9(2):140-8.
PURPOSE: PD 0313052 is a potent, direct factor Xa (FXa) inhibitor (Ki = 0.33 nM) and its antithrombotic effect has been previously demonstrated in several animal models, via intravenous (IV) administration. In the present study, we evaluated four different subcutaneous (SC) formulations to test the feasibility of developing PD 0313052 as a subcutaneous agent. METHODS: PD 0313052 was formulated in saline, methylcellulose (MC, 0.5% methylcellulose solution containing 1% Tween-80), sesame oil, and F127 (25% aqueous solution). Each formulation was injected subcutaneously into rabbits and the relative plasma exposure and the duration of action of PD 0313052 were assessed. Plasma concentration, FXa activity, and coagulation parameters were used to monitor the pharmacokinetic (PK) and pharmacodynamic (PD) profiles of PD 0313052. RESULTS: Regardless of formulation, there was a significant (p < 0.05) correlation between PD 0313052 plasma concentration and FXa activity (R2 = 0.90), prothrombin time (PT) (R2 = 0.86), and Heptest (R2 = 0.93). The saline and MC formulations had similar effects on FXa activity, coagulation parameters, and Heptest, peaking at 30 to 120 minutes after administration and decreasing rapidly thereafter. In contrast, formulations of F127 and sesame oil yielded lower maximal effects on PD markers but produced sustained PD effects over time. CONCLUSION: The data indicate that PD 0313052 is bioavailable after SC administration to rabbits and that there is a strong correlation between the PD parameters and plasma concentrations of PD 0313052. Modifications in the formulation of PD 0313052 produce marked differences in the PK and PD profiles of this agent after SC administration to rabbits. These results suggest that SC formulations can be optimized to improve the PK and PD profiles of PD 0313052, and that PD 0313052 is a viable candidate for development as a SC antithrombotic agent. [Abstract/Link to Full Text]

Yasuda S, Itagaki S, Hirano T, Iseki K
Effects of sex hormones on regulation of ABCG2 expression in the placental cell line BeWo.
J Pharm Pharm Sci. 2006;9(1):133-9.
PURPOSE: The aim of this study was to elucidate the effects of sex hormones that are secreted during gestation from the placenta on ABCG2 mRNA and protein expression levels by using the placental cell line BeWo. METHODS: We investigated the effects of estrogens (estrone, 17-beta-estradiol and estriol) on the expression level of ABCG2 mRNA by RT-PCR. The expression level of ABCG2 protein was analyzed by Western blot analysis. We also investigated the localization of ABCG2 in BeWo cells by Western blot analysis of the plasma membrane fraction and by immunohistochemistry. RESULTS: It was found that all estrogens induce the expression of ABCG2 mRNA in a concentration-dependent manner. Furthermore, Western blot analysis showed that 17-beta-estradiol induces the expression of ABCG2 protein. Western blot analysis of the plasma membrane fraction and immunohistochemistry showed that ABCG2 localized on only the apical side of BeWo cells and that 17-beta-estradiol had no effect on the localization of ABCG2. In addition, progesterone suppressed the induction of ABCG2 expression by 17-beta-estradiol at 1-10 microM. CONCLUSION: The expression of ABCG2 in the placenta is regulated by estrogen and progesterone during gestation. [Abstract/Link to Full Text]

Azarmi S, Huang Y, Chen H, McQuarrie S, Abrams D, Roa W, Finlay WH, Miller GG, L�benberg R
Optimization of a two-step desolvation method for preparing gelatin nanoparticles and cell uptake studies in 143B osteosarcoma cancer cells.
J Pharm Pharm Sci. 2006;9(1):124-32.
PURPOSE: To establish a matrix of parameters to synthesize nanoparticles of different sizes and to investigate the cellular uptake of these nanoparticles by osteosarcoma cancer cells in order to investigate their potential as therapeutic drugdelivery carriers. METHODS: Gelatin A and B were used to synthesize nanoparticles by a two-step desolvation process. Different parameters were investigated, including temperature, pH, concentration of glutaraldehyde, type of desolvating agent and nature of gelatin. For cell uptake studies, Texas Red labeled nanoparticles were incubated with 143B osteosarcoma cells and then evaluated using confocal laser scanning microscopy (CLSM). RESULTS: The systematic investigation of the synthesis parameters showed that it is possible to prepare gelatin-based nanoparticles with different particle sizes and a narrow size distribution. Temperature and nature of the gelatin were the most important synthesis factors. Bioimaging using CLSM showed uptake of the nanoparticles by 143B osteosarcoma cancer cells. CONCLUSIONS: Osteosarcoma cancer cells take up gelatin nanoparticles. This might improve the clinical effectiveness of anti-cancer treatments if nanoparticles are used as a drug delivery system and has important implications for future cancer treatment strategies. [Abstract/Link to Full Text]

Karimi G, Fatehi Z, Gholamnejad Z
The role of nitric oxide and protein kinase C in lipopolysaccharidemediated vascular hyporeactivity.
J Pharm Pharm Sci. 2006;9(1):119-23.
PURPOSE: Overactivation of nitric oxide and protein kinase C (PKC) pathway has been reported to play a role in the pathogenesis of vascular hyporesponsiveness of endotoxic shock. In this study we investigated the role of nitric oxide and PKC in lipopolysaccharide (LPS) mediated vascular hyporeactivity. METHODS: Contraction to phenylephrine and endothelium-dependent and independent vasodilation in the presence and absence of a nonspecific NO inhibitor (L-NAME) and potent PKC inhibitor (chelerythrine) were examined. RESULTS: In LPS treated rats, contractile response of aortic rings to phenylephrine and relaxation in response to acetylcholine were reduced, but relaxation induced by sodium nitroprusside remained unchanged. The attenuation of contractile response to phenylephrine in the presence of L-NAME and chelerythrine was more pronounced in aortic ring isolated from LPS treated rats than control. L-NAME decreased acetylcholine -dependent vasodilation in both group but it was more pronounced in LPS treated rats. Chelerythrine pretreatment improved maximal relaxation to acetylcholine in aortic ring isolated from LPS treated rats. CONCLUSION: These data indicate that the vascular hyporesponsiveness to phenylephrine and acetylcholine after treatment with LPS may be related to an enhanced NO production in the smooth muscle cells and PKC plays a role as an intracellular mediator of LPS-induce NOS activity and vascular suppression. [Abstract/Link to Full Text]

Mehvar R
Interdependency of pharmacokinetic parameters: a chicken-and-egg problem? Not!
J Pharm Pharm Sci. 2006;9(1):113-8.
Pharmacokinetic (PK) software packages are widely used by scientists in different disciplines to estimate PK parameters. However, their use without a clear understanding of physiological parameters affecting the PK parameters and how different PK parameters are related to each other may result in erroneous interpretation of data. Often, mathematical relationships used for the estimation of PK parameters obscure the true physiological relationships among these parameters, prompting a discussion of which parameter came first and giving the appearance of the-chicken-and-the-egg dilemma. In this article, the author attempts to show how different PK parameters are related to physiological parameters and each other by using various scenarios and examples. In particular, the relationship between clearance and the rate of elimination and that among the other major PK parameters are explored. It is concluded that there is no dilemma in interdependency of the PK parameters, and the relationships among the PK parameters and between PK and physiological parameters are clear. [Abstract/Link to Full Text]

Takekuma Y, Takenaka T, Kiyokawa M, Yamazaki K, Okamoto H, Kitabatake A, Tsutsui H, Sugawara M
Contribution of polymorphisms in UDP-glucuronosyltransferase and CYP2D6 to the individual variation in disposition of carvedilol.
J Pharm Pharm Sci. 2006;9(1):101-12.
PURPOSE: It has been reported that carvedilol, which has beta-adrenergic blocking and vasodilating activities, is mainly metabolized by UDP-glucuronosyltransferase (UGT) 1A1, UGT2B4, UGT2B7 and CYP2D6. The aim of this study was to determine whether the activity of glucuronidation has an influence on the area under the curve (AUC) of carvedilol and whether polymorphisms in UGTs and CYP2D6 contribute to individual variation in disposition of carvedilol in Japanese. METHODS: Plasma concentrations of carvedilol and its glucuronide were determined by reversed-phase high-performance liquid chromatography (HPLC). Genotyping of UGT1A1, UGT2B4 and UGT2B7 genes was carried out by the direct sequence method. CYP2D6 genotyping was carried out using an amplification refractory mutation system (ARMS) assay and PCR-restriction fragment length polymorphism (RFLP). RESULTS: The level of carvedilol glucuronidation ability in the high-level AUC group was significantly lower than that in the low-level group. The frequencies of UGT1A1*6, UGT2B7*3 and CYP2D6*10 in the low level ability of glucuronidation group were significantly higher than those in the high level group, and the same tendency was found in the frequency of CYP2D6*5, though there was no significant difference. CONCLUSION: Polymorphisms of UGT1A1, UGT2B7 and CYP2D6 strongly affect the pharmacokinetics and disposition of carvedilol in Japanese. [Abstract/Link to Full Text]

Zhao B, Moochhala SM, Lu J, Tan D, Lai MH
Determination of pyridostigmine bromide and its metabolites in biological samples.
J Pharm Pharm Sci. 2006;9(1):71-81.
Pyridostigmine bromide (PB) is a quartenary ammonium compound that inhibits the hydrolysis of acetylcholine by competitive reversible binding to acetylcholinesterase. PB is used for the symptomatic treatment of myasthenia gravis and has been applied as a prophylaxis against nerve agents. Many studies on PB have involved the reliance on techniques that extract and quantify PB in biological samples. This article presents an overview of the currently applied methodologies for the determination of PB and its metabolites in various biological samples. Articles published from January 1975 to the July 2005 were taken into consideration for the discussion of the metabolism and analytical method of PB. HPLC and GC methods have been used and discussed in most of the references cited in this review. Other methods such as RIA and CE that have been recently reported are also mentioned in this article. Basic information about the type of sample used for analysis, sample preparation, chromatographic column, mobile phase, detection mode and validation data are summarized in a table. [Abstract/Link to Full Text]

Mao ZL, Tam YK, Coutts RT
Effect of protein and calorie malnutrition on drug metabolism in rat - in vitro.
J Pharm Pharm Sci. 2006;9(1):60-70.
PURPOSE: To study the effect of protein and calorie malnutrition on in vitro drug metabolism of protein and calorie malnourished juvenile and adult rats. METHOD: Microsomal incubation was used as a means of monitoring drug metabolism changes, HPLC was employed to quantify metabolites and enzyme immunoassay (EIA) was used for rat growth hormone (rGH) monitoring. RESULTS: Protein and calorie malnutrition significantly decreased levels of microsomal protein and total P450. Microsome of protein and calorie malnourished rats showed impaired testosterone 16alpha- and 2alpha- hydroxylation (CYP2C11), testosterone 6beta-hydroxylation (CYP3A), and testosterone 7alpha-hydroxylation (CYP2A1). Testosterone 16beta-hydroxylation (CYP2B1) did not show any significant change, neither in capacity nor affinity. The quantity and the secretion pattern of rGH were not altered in protein and calorie malnourished rats compared to those in healthy animals. CONCLUSIONS: Serum albumin is not a good indicator of malnutrition. The capacity and affinity of CYP2C11, CYP3A and CYP2A1 were compromised by protein and calorie malnutrition. The impairment of drug metabolism in protein and calorie malnourished rats was not caused by the alteration of rGH. [Abstract/Link to Full Text]

Rohra DK, Gilani AH, Memon IK, Perven G, Khan MT, Zafar H, Kumar R
Critical evaluation of the claims made by pharmaceutical companies in drug promotional material in Pakistan.
J Pharm Pharm Sci. 2006;9(1):50-9.
BACKGROUND: In Pakistan, there is no mechanism to monitor the drug promotional campaign by pharmaceutical industry despite the fact that there is enough evidence that irrational pharmacotherapy is increasingly encountered even in the developed countries due to unethical practices of pharmaceutical promotion. Objectives. To audit the drug promotional claims made by the pharmaceutical companies in Pakistan. METHODS: Drug promotional pamphlets and brochures containing claims for the drugs, which were circulated by the pharmaceutical representatives were collected from 122 general practitioners (GPs) from Karachi and Larkana cities of the Sindh Province. The claims were critically analyzed and audited with the help of currently available evidence in the medical literature. RESULTS: 345 distinct advertisements covering 182 drugs from different manufacturers were critically analyzed for information content. Sixty two out of 345 (18%) of the reviewed advertisements were adjudged to be misleading / unjustifiable, which were again classified as, exaggerated (32%), ambiguous (21%), false (26%), and controversial (21%). The primary source of information (approximately 78%) about the newly launched drugs for the GPs was found to be the pharmaceutical representatives followed by hospital doctors (5%) and colleagues (5%). Furthermore, 110 (90%) GPs were of the view that the drug promotion has definitely an influence on their prescribing pattern. CONCLUSIONS: Since GPs in Pakistan rate pharmaceutical companies as their primary source of information regarding drugs, it can be anticipated that inappropriate advertisement claims would lead to irrational prescribing if physicians had no any other information to follow. [Abstract/Link to Full Text]

L�benberg R, Steinke W
Investigation of vitamin and mineral tablets and capsules on the Canadian market.
J Pharm Pharm Sci. 2006;9(1):40-9.
PURPOSE: The goal of this study was to investigate the disintegrating properties of tablets and capsules containing minerals and vitamins commercially available on the Canadian market and to review their label information. METHODS: The labels were examined for product-related information. The first disintegration test stage was performed using Simulated Intestinal Fluid (SIF) pH 6.8 for 20 minutes. Products which did not disintegrate were further investigated using USP disintegration conditions for dietary supplements. RESULTS: The provided label information is difficult to understand and in some cases pseudo-scientific. Thirty out of thirty-nine tablets and six out of ten capsules had a Drug Identification Number (DIN). Twenty-one of thirty-nine tablets and four out of the ten capsules did not disintegrate within 20 minutes. Using the USP disintegration conditions for dietary supplements nine tablet products did not fully disintegrate but all capsules passed the test. None of the three "time-released" products disintegrated under the applied conditions. CONCLUSIONS: Industry should follow already existing label recommendations more closely to allow the consumers to make an informed decision on their products by providing only essential information rather than using pseudo-scientific terms. The results of the disintegration study indicated that disintegration, one of the most basic quality control parameters, is still a concern for dietary supplements. [Abstract/Link to Full Text]

Tirumalasetty PP, Eley JG
Permeability enhancing effects of the alkylglycoside, octylglucoside, on insulin permeation across epithelial membrane in vitro.
J Pharm Pharm Sci. 2006;9(1):32-9.
PURPOSE: To evaluate the permeability enhancing effects of octylglucoside (OG) for molecules with poor absorption such as insulin by in vitro cell models. METHODS: Transepithelial electrical resistance (TEER) was monitored to ensure monolayer integrity. Permeability was ascertained using paracellular markers. Markers and insulin were dissolved in Hanks balanced salt solution and placed on the apical side of the cells in Transwell(c) plates and allowed to diffuse under sink conditions. RESULTS: The effect of OG on the permeability of molecules across both monolayers was concentration and time dependent. Enhanced transport of the three molecules was observed across both monolayers treated with OG as compared to untreated monolayers. The effects of OG were reversible at low concentrations but there was permanent damage to cells at higher concentrations. Absorption enhancement was greater across T-84 monolayers compared to Caco-2 monolayers. CONCLUSIONS: The results indicate OG has potential as a permeability enhancer for poorly absorbed drugs with no significant damage to monolayers at low concentrations. Immediate attenuation in TEER upon exposure to OG indicates that permeability enhancing effects were likely to be associated with modulation of tight junctions suggesting the involvement of paracellular transport. [Abstract/Link to Full Text]

Dora CL, Alvarez-Silva M, Trentin AG, de Faria TJ, Fernandes D, da Costa R, Stimamiglio M, Lemos-Senna E
Evaluation of antimetastatic activity and systemic toxicity of camptothecin-loaded microspheres in mice injected with B16-F10 melanoma cells.
J Pharm Pharm Sci. 2006;9(1):22-31.
PURPOSE: The aim of this work was to evaluate the pulmonary antimetastatic activity and the systemic toxicity of camptothecin-loaded microspheres. METHODS: PCL microspheres containing camptothecin (CPT) were prepared by the emulsion solvent/evaporation method and characterized according to their encapsulation efficiency, particle size, morphology, and drug release. The ability of CPT to inhibit the lung metastasis was verified using an experimental mouse model intravenously injected with metastatic B16- F10 melanoma cells. The microspheres and the free drug were given intraperitoneally at a dose of 7 mg/kg at intervals of three or five days for 24 days. The systemic toxicity of CPT was evaluated by weight measurements, survival and hemograms of the animals. RESULTS: The encapsulation efficiency was nearly 80%. The drug release was complete after 72 hours, but the burst effect increased from 7% to 35% with the increase in CPT content in the particles. It was observed during the in vivo essays that all groups treated with CPT had a decrease of nearly 70% in the number of lung metastases. However, systemic toxicity was verified in animals that received the free drug. CONCLUSION: Camptothecin-loaded microspheres demonstrated similar therapeutic efficacy when compared to those of the free drug, but the toxicity was significantly reduced. [Abstract/Link to Full Text]

Kim JY, Kim YC, Lee MG, Kwon JW, Yoo M
Effects of water deprivation on the pharmacokinetics of DA-8159, a new erectogenic, in rats.
J Pharm Pharm Sci. 2006;9(1):10-21.
PURPOSE: To test the effect of 72 h water deprivation on the non-renal clearance (CL) of DA-8159 in a rat model of dehydration. DA-8159 is mainly metabolized via CYP3A1/2 and the expression and mRNA level of CYP3A1/2 are not affected by dehydration. METHODS: DA-8159 (30 mg/kg) was administered intravenously or orally to male control Sprague Dawley rats and rat model of dehydration. RESULTS: As expected, after intravenous administration, the CL(NR) values of DA-8159 were comparable between two groups of rats. This could be supported by comparable intrinsic CL of DA-8159 using hepatic microsomes for both groups of rats. However, the CL was significantly slower in rat model of dehydration due, at least in part, to significantly slower renal CL in rat model of dehydration. The slower CL(R) in rat model of dehydration could be due to urine flow ratedependent renal CL of DA-8159; the less urine output, the less the urinary excretion of unchanged DA-8159. After oral administration, the AUC values of DA-8159 were not significantly different between two groups of rats, although the AUC of DA-8159 in rat model of dehydration was significantly greater than controls after intravenous administration. This could be possibly due to changes in the intestinal first-pass effects in rat model of dehydration. CONCLUSIONS: After intravenous administration of DA-8159, the non-renal CL values were comparable between two groups of rats due to the lack of effect of dehydration on CYP3A1/2. [Abstract/Link to Full Text]

Liu AH, Lin YH, Yang M, Sun JH, Guo H, Guo DA
High-performance liquid chromatographic determination of tanshinones in the roots of Salvia miltiorrhiza and related traditional chinese medicinal preparations.
J Pharm Pharm Sci. 2006;9(1):1-9.
PURPOSE: This paper describes a validated high-performance liquid chromatographic method to quantitate four tanshinones as markers; dihydrotanshinone I, cryptotanshinone, tanshinone I and tanshinone IIA for use in the quality control of the roots of Salvia miltiorrhiza and its related traditional Chinese medicinal preparations. METHODS: Separation was achieved using a Zorbax Extend C18 reserved-phase column (5microm, 250*4.6mm) at 20 degrees with a gradient mixture of deionized water and acetonitrile at a flow rate of 1.2ml/min. RESULT: The limits of quantitation were 0.13, 0.08, 0.06 and 0.05microg/ml for dihydrotanshinone I, cryptotanshinone, tanshinone I and tanshinone IIA, respectively. This method provided good reproducibility and sensitivity for the quantification of four tanshinones with overall RSD values for intra-day and inter-day precision and accuracy better than 3.8% and higher than 94.9%, respectively. The recovery of the method was 95.4-104.4% for all the tanshinones and showed good linearity (r>0.9998) over a relatively wide concentration range. CONCLUSIONS: This assay was successfully applied to the determination of four tanshinones in the roots of Salvia miltiorrhiza and its related traditional Chinese medicinal preparations. The results indicated that the HPLC assay could be readily utilized as a quality control method for the roots of Salvia miltiorrhiza and its related traditional Chinese medicinal preparations. [Abstract/Link to Full Text]

Kulmatycki KM, Jamali F
Drug disease interactions: role of inflammatory mediators in disease and variability in drug response.
J Pharm Pharm Sci. 2005;8(3):602-25.
Expression of both pro- and anti-inflammatory mediators are influenced by various factors such as rheumatic diseases, myocardial infarction, angina, aging, obesity and pharmacotherapy. This has therapeutic consequences. Clearance of highly bound and efficiently metabolized drugs may be reduced in the presence of inflammation amounting to increased circulating drug concentration. In the meantime, various cardiovascular receptors are down-regulated in the presence of pro-inflammatory mediators. Consequently, conditions such as rheumatoid arthritis, aging and obesity results in reduced response to drugs such as verapamil despite increased drug concentration. The inflammatory response is a complex cascade of non-specific events resulting in excessive generation of inflammatory mediators such as cytokines, C-reactive protein and nitric oxide by cells of the innate (macrophages, monocytes, neutrophils) and adaptive (T-lymphocytes) arms of the immune system. T-lymphocytes secrete various pro- and anti-inflammatory cytokines during an inflammatory event. In general, two distinct subpopulations of these T-helper cells exist, anti-inflammatory Th2 and pro-inflammatory Th1. As a common rule, Th1 cytokines suppress Th2 and vice-versa. Hence, a balance of these activities is desired. Drugs such as antirheumatoid agents, angiotensin II blockers and hydroxymethyl-glutaryl-CoA reductase inhibitor (statin) may help to restore the Th1/Th2 balance. In general, at least for some conditions, the challenge of therapeutic drug monitoring will be more useful if expression of inflammatory mediators is also taken into account. In addition, some of the intersubject variation in pharmacotherapy and clinical trails may be attributed to variations in the inflammatory mediator's concentration. A detail list of conditions and drugs that influence expression of the inflammatory mediators are provided and potential therapeutic consequences are discussed. [Abstract/Link to Full Text]

Choisnard L, G�ze A, Bigan M, Putaux JL, Wouessidjewe D
Efficient size control of amphiphilic cyclodextrin nanoparticles through a statistical mixture design methodology.
J Pharm Pharm Sci. 2005;8(3):593-601.
PURPOSE: the aim of the study was to investigate size control of amphiphilic beta-cyclodextrin nanoparticles obtained by solvent displacement technique. METHODS: An experimental design methodology for mixture design was undertaken using D-optimal approach with the following technique variables: water fraction X1 (40-70% v/v), acetone fraction X2 (0-60% v/v) and ethanol fraction X3 (0-60% v/v). RESULTS: The resulting quadratic model obtained after logarithmic transformation of data and partial least-square regression was statistically validated and experimentally checked. Also, the morphology of the colloidal nanoparticles from selected experiments was observed by cryo-transmission electron microscopy. CONCLUSIONS: This experimental design approach allowed to produce interesting amphiphilic beta-cyclodextrin nanoparticles with a predicted mean size varying from 60 to 400 nm. [Abstract/Link to Full Text]

Carrasco R, Padr�n JA, P�rez R, Rodr�quez H, Su�rez M, Ochoa C
Quantitative structure antitumoral-activity relationships of thiadiazinthione derivatives using the novel hybrid molecular index pMRchi.
J Pharm Pharm Sci. 2005;8(3):586-92.
PURPOSE: The recently defined molar-refractivity-partition index was applied to a family of 1,3,5- thiadiazin-2-thione derivatives in order to establish quantitative structure-antitumoral models. The goal of this effort is to establish the relationships between the structure and biological response of these compounds. METHOD: After the splitting of the sample in two sets, their indices were correlated against the measured biological activity. The combined use of our index with others had been able to describe not only the topologic but also the London dispersive forces of any fragment in relation to the biological response of the sets. RESULTS: The obtained models showed correlation coefficients of 0.87 and 0.81 respectively linking structural and biological features of the molecules. The mean relative error values were less than 7%. According to the models, the activity of the first sample is related mostly to molecular topology and dispersive forces. Sample two activity was associated to the size and branching of the substituents, and also to the London forces. CONCLUSION: The index was able to discriminate between pure topological features and those related to dispersive forces. [Abstract/Link to Full Text]

Seebacher W, Weis R, Kaiser M, Brun R, Saf R
Synthesis of 2-azabicyclo[3.2.2]nonanes from bicyclo[2.2.2]octan-2-ones and their activities against Trypanosoma brucei rhodesiense and Plasmodium falciparum K1.
J Pharm Pharm Sci. 2005;8(3):578-85.
PURPOSE: New 2-azabicyclo[3.2.2]nonanes were prepared from antiprotozoal bicyclo[2.2.2]octan-2-ones to investigate the influence of the replacement of the rigid bicyclo-octane structure by the more flexible bicyclo-nonane system on the antiplasmodial and antitrypanosomal activity. METHODS: The 2-azabicyclo[3.2.2]nonanes were synthesized via a one-step procedure from bicyclo[2.2.2]octan-2-ones and tested for their activities against Trypanosoma b. rhodesiense and Plasmodium falciparum K1 (resistant to chloroquine and pyrimethamine) using in vitro microplate assays. RESULTS: 2-azabicyclo[3.2.2]non-5-ylamines exhibit higher antiprotozoal activities than 4-aminobicyclo[2.2.2]octanes, 4-aminobicycl [2.2.2]octan-2-ones and 4-amino-2-azabicyclo[3.2.2]nonan-3-ones. (7, 8-Diphenyl-2-azabicyclo[3.2.2]non-5-yl)-dimethylamine shows enhanced anti-trypanosomal (IC50 = 0.60 microM) and remarkable antiplasmodial (IC50 = 0.28 microM) activity. However, the in vivo activity of this compound against Plasmodium berghei in mice is moderate. CONCLUSIONS: Due to their promising in vitro antiprotozoal activity and their low cytotoxicity, 2-azabicyclo[3.2.2]nonanes should serve as lead compounds for further modifications. [Abstract/Link to Full Text]

Sriram D, Bal TR, Yogeeswari P
Aminopyrimidinimino isatin analogues: design of novel non- nucleoside HIV-1 reverse transcriptase inhibitors with broad-spectrum chemotherapeutic properties.
J Pharm Pharm Sci. 2005;8(3):565-77.
PURPOSE: HIV is the most significant risk factor for many opportunistic infections such as tuberculosis, hepatitis, bacterial infections and others. In this paper, we describe an aminopyrimidinimino isatin lead compound as a novel non-nucleoside reverse transcriptase inhibitor with broad-spectrum chemotherapeutic properties for the effective treatment of AIDS and AIDS-related opportunistic infections. METHODS: The synthesis of various aminopyrimidinimino isatin derivatives was achieved in two steps and evaluated for anti-HIV, anti-HCV, antimycobacterial and antibacterial activities. RESULTS: Compound 1-cyclopropyl-6-fluoro-1,4-dihydro-4-oxo-7[[N4-[3'-(4'-amino-5'-trimethoxybenzylpyrimidin-2'-yl)imino-1'-isatinyl] methyl]N1-piperazinyl]-3-quinoline carboxylic acid (14) emerged as the most potent broad-spectrum chemotherapeutic agent active against HIV, HCV, M. tuberculosis and various pathogenic bacteria. Among the synthesized compounds compound 14 and 15 emerged as more promising broad-spectrum chemotherapeutic agents. [Abstract/Link to Full Text]

Chattopadhyay D, Arunachalam G, Ghosh L, Rajendran K, Mandal AB, Bhattacharya SK
Antipyretic activity of Alstonia macrophylla Wall ex A. DC: an ethnomedicine of Andaman Islands.
J Pharm Pharm Sci. 2005;8(3):558-64.
PURPOSE: Alstonia macrophylla Wall ex A. DC. Leaf, used in different ailments by the Onge tribes of Little Andaman Island, India, was investigated for its antipyretic potential. METHODS: The methanol extract and its fractions were tested on normal body temperature and yeast-induced pyrexia in Wistar Albino rats. RESULTS: The leaf extract at oral doses of 200 and 300 mg/kg, and the n-butanol fractions of the extract at 50 mg/kg showed significant reduction in normal body temperature and yeast-provoked elevated temperature in a dose-dependent manner comparable to that of standard antipyretic drug paracetamol. The antipyretic effect was started at 1 h and extended for at least 5 h after the drug administration. CONCLUSIONS: The antipyretic effect was more pronounced when the fraction A and B was administered together, indicating that both the fractions may contain antipyretic compounds which produce an additive effect in combination. Phytochemically these fractions contain beta-sitosterol and ursolic acid. [Abstract/Link to Full Text]

Balogh J, Bubenik J, Dred�n J, Csempesz F, Kiss D, Zelk� R
The effect of structured triglycerides on the kinetic stability of total nutrient admixtures.
J Pharm Pharm Sci. 2005;8(3):552-7.
PURPOSE: The physical stability of two types of total parenteral nutrient (TPN) admixtures was studied as a function of storage time and temperature. One of them contained only structured triglycerides and the other exclusively long-chain triglycerides as lipid components. METHODS: Droplet size of the mixtures was followed by photon correlation spectroscopy for 10 days. Zeta potential and dynamic surface tension measurements were carried out to evaluate the possible changes in the charge and interfacial surface tension of the emulsion droplets during the storage. pH values were monitored in order to follow the possible decomposition processes in the course of storage. RESULTS: Droplet size of emulsions prepared with lipids containing exclusively long-chain triglycerides showed remarkable increase after 4 days of storage in contrast with that of the mixtures containing structured lipids. CONCLUSIONS: The obtained results indicate that besides the advantageous metabolic effects of structured triglycerides, their application is recommended to improve the physical stability of TPN admixtures. [Abstract/Link to Full Text]

Yamamura S, Takehira R, Kawada K, Katayama S, Nishizawa K, Hirano M, Momose Y
Structural equation modeling of qualification of pharmacists to improve subjected quality of life in cancer patients.
J Pharm Pharm Sci. 2005;8(3):544-51.
PURPOSE: To establish structural equation model (SEM) of subjected quality of life (QOL) in cancer patients taking into account qualification of pharmacists. METHOD: The SEM model was constructed from correlation matrix of the scores of answers of questions to both patients and pharmacists. Data were collected from 15 cancer patients who hospitalized and took opioid analgesics for pain control. The patients were asked 18 questions and pharmacists were asked seven questions. From the correlation matrix among scores of answers, a reasonable model was explored by SEM. RESULTS: Health-related QOL (HRQOL) in cancer patients can be modeled by latent variables consist of contributions from physical, emotional and functional domains. The fitting between data and the model was acceptable by statistical goodness-of-fit (GOF) index. The modeled HRQOL by SEM was weakly correlated with subjected QOL in patients, indicating that subjected QOL in patients would be affected not only by above latent variables but other variables. The model taking into account qualification of pharmacists to improve subjected QOL in patients was also made by SEM. The model was reasonably explained and fitting between data and the model was acceptable from some statistical index. The final model suggests that pharmacist can raise subjected QOL in patients through restraining unpleasant side effects. CONCLUSION: The qualification of pharmacists to improve subjected QOL in patients can be modeled by SEM. The final model suggests that pharmacists with qualification to assess patients' pain status contribute to raise subjected quality of life in cancer patients. [Abstract/Link to Full Text]

Recent Articles in Journal of Drug Targeting

No recent articles are currently available.

Recent Articles in Drug Metabolism and Pharmacokinetics

Yamazaki H, Tanaka K, Gamura S, Hashimoto T, Shimizu M
High-performance liquid chromatographic assay for carboplatin in ultrafiltered plasma combined with hyperbaric oxygenation.
Drug Metab Pharmacokinet. 2006 Oct;21(5):429-31.
A specific, sensitive and reproducible high-performance liquid chromatographic procedure was developed for the quantitative analysis of carboplatin in human plasma. Plasma was ultrafiltered with an Amicon Centrifree system and then injected onto an analytical NH2 column. Carboplatin was monitored at 230 nm and eluted by 10 min using acetonitrile/methanol/5 mM sodium perchlorate buffer (pH 2.4) (75:15:10, v/v) as a mobile phase. The method yielded intra-day and inter-day precision and accuracy of <6% with a linearly from 0.1 to 80 microg/mL and a recovery of >98%. Plasma concentrations of intravenously administered carboplatin in three patients could be determined by this system. Slightly higher plasma concentrations of carboplatin were detected even 30 min after hyperbaric oxygenation therapy for 60 min than expected. The results suggest that this method could be applicable for measurement of carboplatin in plasma samples to evaluate carboplatin therapy together with hyperbaric oxygenation. [Abstract/Link to Full Text]

Iida A, Tomita M, Idota Y, Takizawa Y, Hayashi M
Improvement of intestinal absorption of P-glycoprotein substrate by D-tartaric acid.
Drug Metab Pharmacokinet. 2006 Oct;21(5):424-8.
The purpose of the present experiment was to examine the effects of D-tartaric acid (TA) on intestinal drug absorption under both in situ and in vitro experimental conditions. In the in vitro diffusion chamber experiments, TA (10 mM) added to the mucosal side of rat colon significantly decreased rhodamine123 (Rho 123) transport from the serosal to mucosal side. Since TA has been shown to change the integrity of the epithelial tight junctions in rat colon at low pH conditions, resulting in improved paracellular drug transport, the effect of TA on membrane resistance was examined at pH 7.4 in the present study. It was found that membrane resistance, an indicator of paracellular integrity, did not change at pH 7.4. In the in situ loop method, TA (20 mM) increased the absorption of Rho123 in both ileum and colon but not in jejunum. TA (20 mM) also increased the absorption of daunorubicin in the ileum, but TA (20 mM) did not change the expression level of P-glycoprotein (P-gp). TA (20 mM) significantly inhibited excretion of i.v.-administered Rho123 and daunorubicin into the ileal lumen. In conclusion, for the first time we demonstrated that TA increases the intestinal absorption of P-gp substrates Rho123 and daunorubicin, possibly by modulating the P-gp function without changing the expression level of P-gp in the rat intestine. [Abstract/Link to Full Text]

Shirasaka Y, Kawasaki M, Sakane T, Omatsu H, Moriya Y, Nakamura T, Sakaeda T, Okumura K, Langguth P, Yamashita S
Induction of human P-glycoprotein in Caco-2 cells: development of a highly sensitive assay system for P-glycoprotein-mediated drug transport.
Drug Metab Pharmacokinet. 2006 Oct;21(5):414-23.
The aim of this work is to develop a highly sensitive assay system for P-gp-mediated transport by using two methods, induction of P-gp and short-term culture of Caco-2 cells. To induce P-gp in Caco-2 cells, cells were cultured in vinblastine-containing medium. The mRNA level of P-gp was approximately 7-fold higher in Caco-2 cells cultured with vinblastine (P-gp-induced Caco-2 cells) than in control cells. Western blot analysis showed a significant increase in P-gp expression. After cell differentiation, the mRNA level of P-gp was downregulated, however, P-gp-induced Caco-2 cells still possessed a 5.6-fold higher mRNA level of P-gp compared to control cells. Polarized transport of substrate drugs was greater in the monolayer of P-gp-induced cells than in that of control cells. Moreover, we found that P-gp expression in Caco-2 cells could be further enhanced by applying the higher concentration of vinblastine. Transport activity of P-gp in Caco-2 cells cultured with higher concentration of vinblastine was markedly higher than that in P-gp-induced Caco-2 cells and was comparable with that in MDR1-MDCKII cells. In conclusion, this study provided a stable and highly sensitive in vitro assay system that can identify compounds that are subject to P-gp-mediated efflux. [Abstract/Link to Full Text]

Saitoh H, Kobayashi M, Oda M, Nakasato K, Kobayashi M, Tadano K
Characterization of intestinal absorption and enterohepatic circulation of mycophenolic Acid and its 7-O-glucuronide in rats.
Drug Metab Pharmacokinet. 2006 Oct;21(5):406-13.
To assess the mechanism of gastrointestinal disorders by mycophenolate mofetil (MMF), the intestinal absorption and enterohepatic circulation of mycophenolic acid (MPA), an active metabolite of MMF, and its 7-O-glucuronide (MPAG) were investigated using rat intestinal loops and a linked-rat model. The stability of MPAG in the intestinal fluids, the toxicity of MPA and MPAG to intestinal mucosa, and biliary excretion of MPAG in rats with acute renal failure (ARF) were also characterized. MPA was rapidly and extensively absorbed from the rat intestine whereas MPAG was much less absorbable. When MPA was administered intravenously to bile-donor rats, 1.2% of dose was excreted in bile of receiver rats exclusively as MPAG during 4 h. MPAG was minimally deconjugated in the intestinal fluids. MPAG, but not MPA, significantly enhanced the release of lactate dehydrogenase from intestinal mucosa. When MPA was intravenously administered to ARF rats, the biliary excretion of MPAG significantly increased, compared with that in normal rats. These results demonstrated that MPAG accumulated in the intestinal lumen following biliary excretion and exerted some toxic effect on the intestinal mucosa. It was also suggested that enterohepatic circulation of MPAG under renal dysfunction increased the risk of gastrointestinal disorders due to MPAG. [Abstract/Link to Full Text]

Soyama A, Saito Y, Ohno Y, Komamura K, Kamakura S, Kitakaze M, Tomoike H, Ozawa S, Sawada J
Diverse structures of chimeric CYP-REP7/6-containing CYP2D6 and a novel defective CYP2D6 haplotype harboring single-type *36 and CYP-REP7/6 in Japanese.
Drug Metab Pharmacokinet. 2006 Oct;21(5):395-405.
Chimeric REP7/6 has been used as a marker of CYP2D6 deletion, such as for CYP2D6*5. However, the CYP2D6*10D (*10D) haplotype found in a Japanese population consist of CYP2D6*10B, CYP2D7P-derived 3'-flanking region, and a chimeric repetitive sequence, CYP-REP7/6 (REP7/6) (Ishiguro et al. Clin. Chim. Acta. 2004: 347, 217-221). From our analysis, REP7/6 was found in 26 out of 254 Japanese subjects. Thus, the REP7/6-containing CYP2D6 genes (2D6-REP7/6) were analyzed in detail. In order to specifically detect the 2D6-REP7/6 structure, primers were designed in CYP2D6 intron 6 and the REP7/6 3'-flanking region. Among 26 subjects analyzed by PCR, 5 had 2D6-REP7/6. The other 21 subjects were confirmed to have *5 by another *5-specific primer set. Three out of five subjects with 2D6-REP7/6 had the *10D structure. However, further analysis by PCR and sequencing revealed that their haplotypes were further divided into tandem-type *36-*10D (n=2) and single-type *10D (n=1). The remaining two subjects had a novel type of a *36-containing defective structure that consists of CYP2D6*36 and 3'-flanking REP7/6 (single-type *36-REP7/6). Then, REP7/6 sequences in *5, *10D, *36-*10D, and single-type *36 were determined and classified into 5 types: types A to D for *5, type E for *10D and *36-*10D, and type F for *36. These findings could be useful for accurate determination of *5 and REP7/6-harboring aberrant CYP2D6 haplotypes. [Abstract/Link to Full Text]

Tahara K, Saigusa K, Kagawa Y, Taguchi M, Hashimoto Y
Pharmacokinetics and pharmacodynamics of bisoprolol in rats with bilateral ureter ligation-induced renal failure.
Drug Metab Pharmacokinet. 2006 Oct;21(5):389-94.
The effect of renal failure on the pharmacokinetics and pharmacodynamics of bisoprolol was investigated in bilateral ureter-ligated (BUL) rats. The blood bisoprolol concentrations following 30-min intravenous infusion at a rate of 60 microg/kg/min were higher in renal artery-occluded (RAO) rats than in control rats, and were higher in BUL rats than in RAO rats. Increased blood bisoprolol concentrations accompanied decreased mean systemic clearances: 50.7, 36.4, and 26.2 mL/min/kg in control, RAO, and BUL rats, respectively. The finding indicated that approximately 30% of administered bisoprolol was excreted via the kidney, and that not only the renal clearance but also non-renal clearance of bisoprolol was decreased in BUL rats. The beta-blocking action of bisoprolol was assessed by the reduction in isoproterenol-induced increases in the heart rate. The relationship between blood concentration and the beta-blocking action of bisoprolol in BUL rats was similar to that in control rats. These results suggested that renal excretion and hepatic metabolism of bisoprolol were significantly reduced in BUL rats, but that pharmacodynamics of bisoprolol was not altered by acute renal failure. [Abstract/Link to Full Text]

Takizawa E, Takizawa D, Al-Jahdari WS, Miyazaki M, Nakamura K, Yamamoto K, Horiuchi R, Hiraoka H
Influence of atropine on the dose requirements of propofol in humans.
Drug Metab Pharmacokinet. 2006 Oct;21(5):384-8.
OBJECTIVE: The purpose of this study was to evaluate the effect of atropine on the dose requirement of propofol for induction of anesthesia and propofol concentrations during continuous infusion. METHODS: Study 1: Forty patients were randomly allocated to the control or atropine groups. Induction of anesthesia commenced 3 min following the administration of 0.9% saline or atropine (0.01 mg kg(-1)), using a Diprifuser set to achieve propofol concentration of 6.0 microg mL(-1). The primary end point was the propofol dose per kg at the moment of loss of response to a command. Study 2: Fifteen patients undergoing elective surgery were enrolled. Propofol was administered to all subjects via target-controlled infusion to achieve a propofol concentration at 2.0 microg mL(-1) after intubation. Before and after administration of atropine (0.01 mg kg(-1)), cardiac output (CO) was measured using indocyanine green as an indicator and blood propofol concentration was determined using high-performance liquid chromatography. RESULTS: Study 1: The propofol dose for each group was 2.22+/-0.21 mg kg(-1) for control group and 2.45+/-0.28 mg kg(-1) for atropine, respectively (p=0.014). Study 2: After the administration of atropine, CO was significantly increased from 4.28+/-0.83 to 5.76+/-1.55 l min(-1) (p<0.0001). Propofol concentration was significantly decreased from 2.12+/-0.28 to 1.69+/-0.27 microg mL(-1) (p<0.0001). CONCLUSIONS: Following the administration of atropine, the propofol requirements for the induction of anesthesia were increased and propofol concentrations were decreased during continuous infusion by the administration of atropine. [Abstract/Link to Full Text]

Sugiura T, Kato Y, Kubo Y, Tsuji A
Mutation in an adaptor protein PDZK1 affects transport activity of organic cation transporter OCTNs and oligopeptide transporter PEPT2.
Drug Metab Pharmacokinet. 2006 Oct;21(5):375-83.
Genetic polymorphisms in xenobiotic transporters have recently been clarified to be associated with change in drug distribution and disposition. To expand on recent identification of direct interaction and functional regulation of several transporters by a PDZ (PSD95, Dlg and ZO1) domain containing protein PDZK1, the effect of mutation in PDZK1 on transport activity and subcellular localization of organic cation/carnitine transporters OCTN1 and OCTN2, and oligopeptide transporter PEPT2 was examined in the present study. HEK293 cells stably expressing a mutant transcript PDZK1-E195K (HEK293/PDZK1-E195K) were constructed, followed by transient transfection of cDNA for each transporter. Uptake of tetraethylammonium by OCTN1 was much higher in HEK293/PDZK1 cells, compared with that in the parent HEK293 cells, the uptake in HEK293/PDZK1-E195K cells showing middle range between the two values. Such difference in transport activity was accounted for the difference in transport capacity, with minimal change in affinity of OCTN1 to the substrate or other compounds. The similar difference among HEK293/PDZK1, HEK293/PDZK1-E195K and HEK293 cells was also observed in transport property of OCTN2 and PEPT2, whereas the difference was not so remarkable in each transporter with the last four amino acids deleted, that has much lower interaction potential with PDZK1. Immunohistochemical analysis indicated that OCTN1 was colocalized with PDZK1 on cell-surface, whereas colocalization with PDZK1-E195K was partially observed in cytoplasmic region. These results suggest a novel hypothesis that mutation in PDZK1 potentially changes transport property of various types of xenobiotic transporters by affecting their subcellular localization, possibly leading to change in disposition of various types of substrate drugs. [Abstract/Link to Full Text]

Nishimura M, Naito S
Tissue-specific mRNA expression profiles of human phase I metabolizing enzymes except for cytochrome P450 and phase II metabolizing enzymes.
Drug Metab Pharmacokinet. 2006 Oct;21(5):357-74.
Pairs of forward and reverse primers and TaqMan probes specific to each of 52 human phase I metabolizing enzymes (alcohol dehydrogenase, aldehyde dehydrogenase, aldehyde oxidase, dihydropyrimidine dehydrogenase, epoxide hydrolase, esterase, flavin-containing monooxygenase, monoamine oxidase, prostaglandin endoperoxide synthase, quinone oxidoreductase, and xanthene dehydrogenase) and 48 human phase II metabolizing enzymes (acetyltransferase, acyl-CoA:amino acid N-acyltransferase, UDP-glucuronosyltransferase, glutathione S-transferase, methyltransferase, and sulfotransferase) were prepared. The mRNA expression level of each target enzyme was analyzed in total RNA from single and pooled specimens of various human tissues (adrenal gland, bone marrow, brain, colon, heart, kidney, liver, lung, pancreas, peripheral leukocytes, placenta, prostate, salivary gland, skeletal muscle, small intestine, spinal cord, spleen, stomach, testis, thymus, thyroid gland, trachea, and uterus) by real-time reverse transcription PCR using an ABI PRISM 7700 Sequence Detection System. Further, individual differences in the mRNA expression of representative human phase I and II metabolizing enzymes in the liver were also evaluated. The mRNA expression profiles of the above phase I and phase II metabolizing enzymes in 23 different human tissues were used to identify the tissues exhibiting high transcriptional activity for these enzymes. These results are expected to be valuable in establishing drug metabolism-mediated screening systems for new chemical entities in new drug development and in research concerning the clinical diagnosis of disease. [Abstract/Link to Full Text]

Masubuchi Y
Metabolic and non-metabolic factors determining troglitazone hepatotoxicity: a review.
Drug Metab Pharmacokinet. 2006 Oct;21(5):347-56.
Troglitazone (TGZ), a thiazolidinedione class of antidiabetic agent, causes serious idiosyncratic hepatotoxicity. TGZ is metabolized into reactive metabolites that covalently bind to cellular macromolecules, one of which is oxidation at the chromane ring, a unique structure of TGZ, and another involves oxidative cleavage of the thiazolidinedione ring, a structure common to less hepatotoxic antidiabetics, rosiglitazone and pioglitazone. TGZ is cytotoxic to HepG2 cells and rat and human hepatocytes. However, the role of the reactive metabolite on the TGZ toxicity is controversial, because there was no correlation of the generation of the reactive metabolites with susceptibility to the TGZ cytotoxicity, and chemical inhibitors of drug metabolizing enzymes could not protect the cells against the toxicity. Mitochondrial dysfunction, especially mitochondrial permeability transition, may be a pathophysiological event, which is mediated by TGZ itself and is a major non-metabolic factor. Other events such as apoptosis and PPARgamma-dependent steatosis could be also mediated by TGZ, while inhibition of bile salt export pump, a cause of TGZ-induced cholestasis, may be caused by the TGZ sulfate. In conclusion, although the TGZ is biotransformed into chemically reactive metabolites, there is currently no potential evidence for involvement of the reactive metabolite in the TGZ-induced liver injury. [Abstract/Link to Full Text]

Fukushima-Uesaka H, Saito Y, Maekawa K, Saeki M, Kamatani N, Kajio H, Kuzuya N, Yasuda K, Sawada J
Novel genetic variations and haplotypes of hepatocyte nuclear factor 4alpha (HNF4A) found in Japanese type II diabetic patients.
Drug Metab Pharmacokinet. 2006 Aug;21(4):337-46.
Thirty-nine single nucleotide variations, including 16 novel ones, were found in the 5' promoter region, all of the exons and their surrounding introns of HNF4A in 74 Japanese type II diabetic patients. The following novel variations were identified (based on the amino acid numbering of splicing variant 2): -208G>C in the 5' promoter region; 1154C>T (A385V) and 1193T>C (M398T) in the coding exons; 1580G>A, 1852G>T, 2180C>T, 2190G>A, and 2362_2380delAAGAATGGTGTGGGAGAGG in the 3'-untranslated region, and IVS1+231G>A, IVS2-83C>T, IVS3+50C>T, IVS3-54delC, IVS5+173_176delTTAG, IVS5-181_-180delAT, IVS8-106A>G, and IVS9-151A>C in the introns. The allele frequencies were 0.311 for 2362_2380delAAGAATGGTGTGGGAGAGG, 0.054 for 1580G>A, 0.047 for 1852G>T, 0.020 for IVS1+231G>A, 0.014 for IVS9-151A>C, and 0.007 for the other 11 variations. In addition, one known nonsynonymous single nucleotide polymorphism, 416C>T (T139I), was detected at a 0.007 frequency. Based on the linkage disequilibrium profiles, the region analyzed was divided into three blocks. Haplotype analysis determined/inferred 10, 16, and 12 haplotypes for block 1, 2, and 3, respectively. Our results on HNF4A variations and haplotypes would be useful for pharmacogenetic studies in Japanese. [Abstract/Link to Full Text]

Sasaki T, Goto E, Konno Y, Hiratsuka M, Mizugaki M
Three novel single nucleotide polymorphisms of the human thiopurine S-methyltransferase gene in Japanese individuals.
Drug Metab Pharmacokinet. 2006 Aug;21(4):332-6.
In this study, the entire coding sequence and the exon-intron junctions of the thiopurine S-methyltransferase (TPMT) gene from 200 Japanese individuals were screened for mutation. Three novel single nucleotide polymorphisms (SNPs) were identified-106G>A in exon 3 (Gly36Ser, *20 allele), 967A>G in 3'-untranslated region, and -87C>T in intron 8. The allele frequencies were 0.003 for 106G>A, 0.003 for 967A>G, and 0.010 for IVS8 -87C>T. In addition, the three known SNPs, 474T>C (Ile158Ile), 719A>G (Tyr240Cys, *3C allele), and IVS4 +35C>T were detected at frequencies of 0.299, 0.010, and 0.421, respectively. [Abstract/Link to Full Text]

Tabata K, Katashima M, Kawamura A, Kaibara A, Tanigawara Y
Population pharmacokinetic analysis of micafungin in Japanese patients with fungal infections.
Drug Metab Pharmacokinet. 2006 Aug;21(4):324-31.
The object of this analysis was to develop a population pharmacokinetic model of micafungin, a new anti-fungal agent of the echinocandin class, to optimize dosing in Japanese patients with fungal infections. Population pharmacokinetics parameters were determined using NONMEM based on pharmacokinetic data from 198 subjects in seven clinical studies, comprising four phase I, two phase II and one pediatric phase III study. The healthy subjects received intravenous infusion of 2.5-150 mg micafungin. Adult and pediatric patients, age range of 8 month to 15 yeras old, were received 25-150 mg and 1-6 mg/kg daily, respectively. A total of 1825 micafungin plasma samples were available for this analysis. Two-compartment pharmacokinetic model was adopted. The clearance of micafungin was influenced by body weight in children and platelet counts (PLT). However the PLT accounted for less than 20% of the variation of micafungin clearance in Japanese subjects. In conclusions, body weight is the primary covariate factor in pediatric patients. The dose adjustment by body weight would be required only pediatric patients for the micafungin therapy in Japanese patients with fungal infection. [Abstract/Link to Full Text]

Miyata M, Matsuda Y, Tsuchiya H, Kitada H, Akase T, Shimada M, Nagata K, Gonzalez FJ, Yamazoe Y
Chenodeoxycholic acid-mediated activation of the farnesoid X receptor negatively regulates hydroxysteroid sulfotransferase.
Drug Metab Pharmacokinet. 2006 Aug;21(4):315-23.
Hydroxysteroid sulfotransferase catalyzing bile acid sulfation plays an essential role in protection against lithocholic acid (LCA)-induced liver toxicity. Hepatic levels of Sult2a is up to 8-fold higher in farnesoid X receptor-null mice than in the wild-type mice. Thus, the influence of FXR ligand (chenodeoxycholic acid (CDCA) and LCA) feeding on hepatic Sult2a expression was examined in FXR-null and wild-type mice. Hepatic Sult2a protein content was elevated in FXR-null and wild-type mice fed a LCA (1% and 0.5%) diet. Treatment with 0.5% CDCA diet decreased hepatic Sult2a to 20% of the control in wild-type mice, but increased the content in FXR-null mice. Liver Sult2a1 (St2a4) mRNA levels were reduced to 26% in wild-type mice after feeding of a CDCA diet, while no decrease was observed on Sult2a1 mRNA levels in FXR-null mice after CDCA feeding. A significant inverse relationship (r(2)=0.523) was found between hepatic Sult2a protein content and small heterodimer partner (SHP) mRNA level. PCN-mediated increase in Sult2a protein levels were attenuated by CDCA feeding in wild-type mice, but not in FXR-null mice. Human SULT2A1 protein and mRNA levels were decreased in HepG2 cells treated with the FXR agonists, CDCA or GW4064 in dose-dependent manners, although SHP mRNA levels were increased. These results suggest that SULT2A is negatively regulated through CDCA-mediated FXR activation in mice and humans. [Abstract/Link to Full Text]

Kikuchi A, Nozawa T, Wakasawa T, Maeda T, Tamai I
Transporter-mediated intestinal absorption of fexofenadine in rats.
Drug Metab Pharmacokinet. 2006 Aug;21(4):308-14.
Both influx and efflux transporters are thought to be involved in the intestinal absorption of fexofenadine. The present study examined the influx transporter-mediated intestinal absorption of fexofenadine in rats, focusing on the role of rat oatp3 (Oatp1a5). The intestinal permeability of fexofenadine was evaluated by means of the Ussing chamber method in the presence of a P-glycoprotein inhibitor to block efflux transport. The permeability of fexofenadine from the mucosal to the serosal side was higher than that from the serosal side to the mucosal side. Transport of fexofenadine was saturable, and was significantly decreased by an organic anion transporting polypeptide (oatp) inhibitor. Furthermore, uptake of fexofenadine by Xenopus oocytes expressing rat oatp3 was significantly greater than that by water-injected oocytes, and the affinity of oatp3 for fexofenadine (Km) was about 60 microM, which is comparable with the value obtained by the Ussing chamber method using rat intestinal tissues. These results indicate that oatp3 plays a role as an influx transporter in the intestinal absorption of fexofenadine in rats. [Abstract/Link to Full Text]

Nishimura M, Koeda A, Suzuki E, Kawano Y, Nakayama M, Satoh T, Narimatsu S, Naito S
Regulation of mRNA expression of MDR1, MRP1, MRP2 and MRP3 by prototypical microsomal enzyme inducers in primary cultures of human and rat hepatocytes.
Drug Metab Pharmacokinet. 2006 Aug;21(4):297-307.
The mRNA induction of various transporters by rifampicin (Rif), dexamethasone (Dex) and omeprazole (Ome) was investigated in primary cultures of cryopreserved human and rat hepatocytes. Analysis was performed by quantitative real-time RT-PCR using primers and TaqMan probes. In primary cultures of human hepatocytes, mRNA levels of MDR and MRP1 were increased by about 1.5 fold and 1.3 fold, respectively, by exposure to Rif at 2 to 50 microM as compared with 0.1% DMSO-treated controls. MRP2 mRNA levels in the same human hepatocytes were significantly increased by 1.2 to 1.8 fold by exposure to Rif at 50 microM as compared with controls. In primary cultures of rat hepatocytes, Mdr1a and Mdr1b mRNA levels were not increased or only slightly increased at 24 hr by exposure to any of the inducers at 2, 10 or 50 microM. Mrp2 mRNA levels in the same rat hepatocytes were significantly increased by 7 to 45 fold by exposure to Dex at 2 microM as compared with controls. Based on the species differences observed in the present study, primary cultures of cryopreserved hepatocytes from both the human and rat should be useful in preclinical drug development for evaluating candidate drugs for transporter induction. [Abstract/Link to Full Text]

Aiba T, Horiuchi M, Makita T, Komori Y, Kawasaki H, Kurosaki Y
Peritoneal dialysis alters tolbutamide pharmacokinetics in rats with experimental acute renal failure.
Drug Metab Pharmacokinet. 2006 Aug;21(4):291-6.
The plasma concentration profile of the antidiabetic agent tolbutamide was investigated in glycerol-induced acute renal failure (ARF) rats receiving or not receiving peritoneal dialysis (PD) to assess the impact of performing dialysis on tolbutamide pharmacokinetics. It was revealed that the plasma concentration of tolbutamide was decreased by 23.4% by performing PD in ARF rats, while it was not changed by PD in normal rats. The decrease in the plasma concentration of tolbutamide was nearly proportional to the increase in its volume of distribution. To clarify the mechanisms responsible for the decreased tolbutamide concentration caused by PD, the plasma protein binding of tolbutamide was examined in normal and ARF rats. The plasma unbound fraction of tolbutamide was higher in ARF rats than in normal rats, and the dissociation constants were 3.5+/-0.7 and 5.5+/-0.2 microg in normal and ARF rats, respectively. These results indicated that the unbound fraction of tolbutamide was increased in ARF rats because of its protein binding being suppressed. It is therefore likely that since a measurable amount of tolbutamide can distribute in peritoneal dialysate in ARF rats, but not in normal rats, the plasma concentration of tolbutamide was decreased by performing PD only in ARF rats. These findings suggest that diabetes medication with tolbutamide should be carefully performed in patients receiving dialysis treatment. [Abstract/Link to Full Text]

Tassaneeyakul W, Mahatthanatrakul W, Niwatananun K, Na-Bangchang K, Tawalee A, Krikreangsak N, Cykleng U, Tassaneeyakul W
CYP2C19 genetic polymorphism in Thai, Burmese and Karen populations.
Drug Metab Pharmacokinet. 2006 Aug;21(4):286-90.
The genetic polymorphism of CYP2C19 was examined in three Southeast Asian populations. This study was conducted in 774 Thais, 127 Burmeses and 131 Karens. Genomic DNA was extracted from leucocytes and analyzed by the PCR-RFLP technique. Genotype analysis revealed that the allele frequencies of CYP2C19*1, CYP2C19*2 and CYP2C19*3 in the Thais were 0.68, 0.29 and 0.03, respectively, and those of the Burmese population were 0.66, 0.30 and 0.04, respectively. For Karens, the minority ethnic in Mynmar, the allele frequencies of CYP2C19*1, CYP2C19*2 and CYP2C19*3 were 0.71, 0.28 and 0.01, respectively. The prevalence of PM estimated from genotype data among these three ethnic populations were 9.2%, 11.0%, and 8.4%, respectively. The PM phenotype and the frequencies of CYP2C19 defective alleles, particularly CYP2C19*3 among these three Southeast Asian ethnics appeared to be lower than other Asian populations. Lower prevalence of CYP2C19 PM suggests that these ethnics may have different capacity to metabolize drugs that are substrates of CYP2C19. Certain drug dosage regiments should be considered differently for Asian populations. [Abstract/Link to Full Text]

Aoki K, Kashiwagura Y, Horie T, Sato H, Tateno C, Ozawa N, Yoshizato K
Characterization of humanized liver from chimeric mice using coumarin as a human CYP2A6 and mouse CYP2A5 probe.
Drug Metab Pharmacokinet. 2006 Aug;21(4):277-85.
Coumarin 7-hydroxylation (COH), which is catalyzed almost solely by human CYP2A6 and mouse CYP2A5, shows large differences in activity (humans>mice) and inhibitor specificity between mice and humans. To differentiate human and mouse liver functions of chimeric mice (CM1, CM2 and CM3) prepared with hepatocytes from 3 donors, the microsomal COH activities were measured with and without benzaldehyde and undecanoic gamma-lactone as a specific inhibitor of human CYP2A6 and mice CYP2A5, respectively. The replacement % to human hepatocytes designated as replacement index (RI) was calculated from human specific cytokeratin 8/18 expression in the liver section. The COH activities correlated well with RIs in CM2 (R(2)=0.98) and CM3 (R(2)=0.94), except CM1 whose genotype of donor is CYP2A6*4/*4. However, the COH activities expressed as % of donor activities were not always coincident with RIs, and the inhibition pattern of CM2 and CM3 was human-type after RI exceeded approximately 50%. Subsequently, our attempts to use % of COH activities or inhibition patterns as an accurate functional replacement index were unsuccessful. Since the detection of human CYP2A6 protein in the liver and the steep increase of human albumin (hAlb) levels in the blood were begun from almost RI=50% similarly to the changes of inhibition pattern, RI=50% is the turning point for chimeric mice to have humanized liver function. [Abstract/Link to Full Text]

Shimada T
Xenobiotic-metabolizing enzymes involved in activation and detoxification of carcinogenic polycyclic aromatic hydrocarbons.
Drug Metab Pharmacokinet. 2006 Aug;21(4):257-76.
Polycyclic aromatic hydrocarbons (PAHs) are ubiquitous environmental carcinogens and metabolized by a variety of xenobiotic-metabolizing enzymes such as cytochrome P450 (P450 or CYP), epoxide hydrolase, glutathione transferase, UDP-glucuronosyltransferase, sulfotransferase, NAD(P)H quinone oxidoreductase 1, and aldo-keto reductase. These enzymes mainly participate in the conversion of PAHs to more polar and water-soluble metabolites, and the resultant metabolites are readily excreted from the body. However, during the course of metabolism, a variety of unstable and reactive intermediates of PAHs are formed, and these metabolites attack DNA, causing cell toxicity and transformation. P450s and epoxide hydrolase convert PAHs to proximate carcinogenic metabolites, PAH-diols, and these products are further metabolized by P450s to ultimate carcinogenic metabolites, PAH diol-epoxides, or by aldo-keto reductase to reactive PAH o-quinones. PAHs are also activated by P450 and peroxidases to reactive radical cations that bind covalently to DNA. The oxygenated and reactive metabolites of PAHs are usually converted to more polar and detoxified products by phase II enzymes. Inter-individual differences exist in levels of expression and catalytic activities of a variety of enzymes that activate and/or detoxify PAHs in various organs of humans and these phenomena are thought to be critical in understanding the basis of individual differences in response to PAHs. Factors affecting such variations include induction and inhibition of enzymes by diverse chemicals and, more importantly, genetic polymorphisms of enzymes in humans. [Abstract/Link to Full Text]

Kim SR, Saito Y, Maekawa K, Sugiyama E, Kaniwa N, Ueno H, Okusaka T, Morizane C, Yamamoto N, Ikeda M, Yoshida T, Minami H, Furuse J, Ishii H, Saijo N, Kamatani N, Ozawa S, Sawada J
Thirty novel genetic variations in the SLC29A1 gene encoding human equilibrative nucleoside transporter 1 (hENT1).
Drug Metab Pharmacokinet. 2006 Jun;21(3):248-56.
Thirty-nine genetic variations, including thirty novel ones, were found in the human SLC29A1 gene, which encodes equilibrative nucleoside transporter 1, from 256 Japanese cancer patients administered gemcitabine. The found novel variations included -8,166G>A, -81,10A>G, -7,947G>A, -7,789T>C, -5,595G>A, -3,803_-3,783delTCGGGGAGGTGGCAGTGGGCG, -3,548G>C, -3,414G>A, -1355T>C, -34C>G, IVS1+141G>A, IVS1+260C>T, IVS1-82C>T, 177C>G, IVS3-6C>T, 564C>T, IVS8+44T>C, IVS8+90T>C, IVS8+97T>C, IVS8+131C>T, IVS8+169G>A, 933T>C, 954C>T, IVS11-52G>C, IVS11-46G>A, 1,288G>A, 1,641C>G, 1,703_1,704delGT, 1812C>T, and 1861C>T. The frequencies were 0.051 for IVS8+169G>A, 0.012 for -7,947G>A, 0.006 for IVS1+141G>A and 1,703_1,704delGT, 0.004 for -8,166G>A, -8,110A>G, -3,548G>C, -1,355T>C, -34C>G, IVS8+44T>C, and 1,812C>T, and 0.002 for the other 19 variations. Among them, 177C>G and 1,288G>A resulted in amino acid substitutions Asp59Glu and Ala430Thr, respectively. Using the detected polymorphisms, linkage disequilibrium analysis was performed, and 28 haplotypes were identified or inferred. Our findings would provide fundamental and useful information for genotyping SLC29A1 in the Japanese and probably other Asian populations. [Abstract/Link to Full Text]

Shimizu M, Fujita H, Aoyama T, Yamazaki H
Three novel single nucleotide polymorphisms of the FMO3 gene in a Japanese population.
Drug Metab Pharmacokinet. 2006 Jun;21(3):245-7.
We sequenced all exons and exon-intron junctions of the flavin-containing monooxygenase 3 (FMO3) gene from 2 Japanese individuals and their family members, who were case subjects that showed low FMO3 metabolic capacity among a population of self-reported trimethylaminuria Japanese volunteers. We found two novel single nucleotide polymorphisms (SNPs) (21,254 C>A and 24,006 A>G) causing amino acid substitutions, Thr(201)Lys in exon 5 and Met(260)Val in exon 6, respectively. The Thr(201)Lys and Met(260)Val also presented together with known SNPs (Glu(158)Lys-Glu(308)Gly and Val(257)Met, respectively) in the same alleles of the FMO3 gene to form novel haplotypes. A SNP (30,398 C>T) in the FMO3 gene causing a stop codon at Arg(500) in exon 9 was also discovered. These sequences are as follows: 1) SNP, 060116Shimizu001; GENE NAME, FMO3; ACCESSION NUMBER, AL021026; LENGTH, 25 base; 5'-GTGATATTGCCAC/AAGAACTCAGCCG-3'. 2) SNP, 060116Shimizu002; GENE NAME, FMO3; ACCESSION NUMBER, AL021026; LENGTH, 25 base; 5'-TAC(G/A)TGAAGCAGA/GTGAATGCAAGAT-3'. 3) SNP, 060116Shimizu003; GENE NAME, FMO3; ACCESSION NUMBER, AL021026; LENGTH, 25 base; 5'-CCCATGCAGACAC/TGAGTGGTCGGGA-3'. [Abstract/Link to Full Text]

Ogihara T, Kamiya M, Ozawa M, Fujita T, Yamamoto A, Yamashita S, Ohnishi S, Isomura Y
What kinds of substrates show P-glycoprotein-dependent intestinal absorption? Comparison of verapamil with vinblastine.
Drug Metab Pharmacokinet. 2006 Jun;21(3):238-44.
The influence of P-glycoprotein (P-gp) on intestinal absorption of drugs was investigated by comparison of the uptakes of two P-gp substrates, verapamil and vinblastine, using intestinal segments of wild-type and mdr1a/1b gene-deficient (mdr1a/1b(-/-)) mice, and Caco-2 cells. When [(3)H]vinblastine was injected into intestinal segments of wild-type mice, vinblastine was absorbed from duodenum and ileum, but not from jejunum. This difference among intestinal regions could not be explained by segmental differences of mdr1a mRNA expression. In Caco-2 cells, it was found that vinblastine had a high value of efflux/influx ratio (an index of affinity for P-gp) of 12.1, and a low permeability of less than 1 x 10(-6) cm/sec. The corresponding values for verapamil were 4.9 and 10.6 x 10(-6) cm/sec, respectively. After oral administration of [(3)H]vinblastine to mice, the maximum concentration (C(max)) and the area under the plasma concentration time-curve from time 0 to 24 hr (AUC(0-24 hr)) for mdr1a/1b(-/-) mice were 1.5 times greater than those for wild-type mice, while these parameters were not significantly different between the two strains in the case of [(3)H]verapamil. Therefore, P-gp substrates may be classified into at least two types, i.e., verapamil-type, for which the intestinal absorption is unaffected by P-gp, and vinblastine-type, for which the intestinal absorption is influenced by P-gp. Vinblastine-type P-gp substrates, with low permeability and high affinity for P-gp, would be unfavorable candidates for oral drugs. [Abstract/Link to Full Text]

Nagira M, Tomita M, Mizuno S, Kumata M, Ayabe T, Hayashi M
Ischemia/reperfusion injury in the monolayers of human intestinal epithelial cell line caco-2 and its recovery by antioxidants.
Drug Metab Pharmacokinet. 2006 Jun;21(3):230-7.
We previously established a in vitro system for assessing early ischemia/reperfusion injury using monolayers of human intestinal epithelial cell line Caco-2, in which lipid peroxidation caused by tertiary-butylhydroperoxide (t-BuOOH), a lipid peroxidation inducer, acts as a trigger of the injury. By now, we have shown that superoxide anion participates in the opening of tight junctions (TJ) induced by reoxygenation following the induction of lipid peroxidation by t-BuOOH at a low concentration. The present objectives are to elucidate the dysfunction of P-glycoprotein (P-gp) in addition to the opening of TJ by t-BuOOH at a high concentration condition using rhodamine123 (Rho123) as a P-gp substrate and cyclosporine A (CyA) as a P-gp inhibitor. Also, we compared the inhibition effect of lutein and other compounds such as biliverdin as a radical scavenger on the opening of TJ and the dysfunction of P-gp. t-BuOOH at a high concentration increased the permeability of Rho123 in the apical to basal direction and decreased basal to apical direction when compared with control conditions. t-BuOOH at a high concentration showed no significant difference between directional transport of Rho123 and no inhibition was observed in the permeability of both directions by CyA. The staining intensity of Western blot was decreased by t-BuOOH at a high concentration. Although lutein and the other compounds had recovery effects on the opening of TJ and P-gp dysfunction induced by t-BuOOH, lutein is more advantageous than other compounds since it has effective effects at the lower concentration. In conclusion, the barrier dysfunction such as the inhibition of P-gp in addition to the opening of TJ was induced by t-BuOOH at a high concentration condition. The above two barrier dysfunctions was ameliorated by antioxidant such as lutein and biliverdin. [Abstract/Link to Full Text]

Fetih G, Habib F, Katsumi H, Okada N, Fujita T, Attia M, Yamamoto A
Excellent absorption enhancing characteristics of NO donors for improving the intestinal absorption of poorly absorbable compound compared with conventional absorption enhancers.
Drug Metab Pharmacokinet. 2006 Jun;21(3):222-9.
The characteristics of NO donors, NOC5 [3-(2-hydroxy-1-(1-methylethyl-2-nitrosohydrazino)-1-propanamine), NOC12 [N-ethyl-2-(1-ethyl-2-hydroxy-2-nitrosohydrazino)-ethanamine] and SNAP [S-nitroso-N-acetyl-DL-penicillamine] as absorption enhancers for poorly absorbable drugs were examined in rats using an in situ closed loop method. They were compared with a group of conventional absorption enhancers including sodium glycocholate (NaGC), sodium caprate (NaCap), sodium salicylate (NaSal) and n-dodecyl-beta-D-maltopyranoside (LM). 5(6)-carboxyfluorescein (CF) was used as a model drug to investigate effectiveness, site-dependency, and concentration-dependency of the tested enhancers. Overall, the NO donors can improve the intestinal absorption of CF at low concentration (5 mM), whereas higher concentration was required for the conventional absorption enhancers to elicit the absorption enhancing effect. In the small intestine, SNAP was the most effective absorption enhancers, although its concentration (5 mM) was lower than the conventional absorption enhancers (20 mM). On the other hand, LM and NaCap as well as the three NO donors were effective to improve the colonic absorption of CF. In the regional difference in the absorption enhancing effects, the NO donors showed significant effects in all intestinal regions, whereas we observed a regional difference in the absorption enhancing effect of the other conventional absorption enhancers. In the conventional enhancers, the absorption enhancing effects were generally greater in the large intestine than those in the small intestine. LM and NaCap were ineffective in the jejunum, although they were effective for improving the absorption of CF in the colon. NaSal was ineffective in both the jejunum and the colon. The absorption enhancement produced by NO donors was greatly affected by increasing the enhancer concentration from 3 to 5 mM, but only a slight increase was obtained when the concentration was raised to 10 mM. Similar results were obtained for the other enhancers over the range of 10 to 20 mM, but the absorption enhancing effects of these enhancers were almost saturated above these concentrations. These results suggest that NO donors possess excellent effectiveness as absorption enhancers for poorly absorbable drugs compared with the conventional enhancers. They can enhance intestinal absorption of CF from all intestinal regions and they are effective at very low concentrations. [Abstract/Link to Full Text]

Eto N, Tomita M, Hayashi M
NaPi-mediated transcellular permeation is the dominant route in intestinal inorganic phosphate absorption in rats.
Drug Metab Pharmacokinet. 2006 Jun;21(3):217-21.
Inorganic phosphate in food is absorbed two ways, the transcellular route via the brush border membrane and the paracellular route via tight junctions. NaPi, a sodium-dependent inorganic phosphate transporter, is expressed in rat and human intestine. However, the relative contribution of NaPi to total carrier-mediated transport of physiological concentrations of inorganic phosphate in rat intestine is not clear. Here, we characterized inorganic phosphate transport across the rat small intestine using a voltage-clamp analysis which allowed the diffrentiation of inorganic phosphate permeation through these two (transcellular and paracellular) routes. Results showed that, under a physiologically normal transmucosal electrical potential difference (about 2 mV), permeation of inorganic phosphate by the transcellular route was greater than that by the paracellular route. Further, transport was significantly decreased by the addition to the incubation medium of phosphonoformic acid, a sodium-dependent phosphate transporter inhibitor, and severely inhibited under sodium-free conditions. Similar results were obtained without the voltage-clamp. Together, these results suggest that NaPi-mediated transcellular permeation is the dominant route in the absorption of inorganic phosphate across the small intestine. [Abstract/Link to Full Text]

Soyama A, Saito Y, Kubo T, Miyajima A, Ohno Y, Komamura K, Ueno K, Kamakura S, Kitakaze M, Tomoike H, Ozawa S, Sawada J
Sequence-based analysis of the CYP2D6*36-CYP2D6*10 tandem-type arrangement, a major CYP2D6*10 haplotype in the Japanese population.
Drug Metab Pharmacokinet. 2006 Jun;21(3):208-16.
The frequency of the CYP2D6*10 allele (100C>T) in the Japanese is relatively high (0.3-0.4), and the two *10-related genes, Ch1 (currently *10B) and Ch2 (*36), and their tandem arrangement Ch(2)-Ch(1) (*36-*10B) have been reported. Although the tandem form of *36-*10 is assumed to be a major form, no detailed information has been reported for its intervening and flanking regions. Thus in this study, the tandem-type *36-*10B and the single-type *10 were analyzed by long-range PCR and sequencing of the subsequent nested PCR products. The sequence of the entire *36-*10 region confirmed the recombination of CYP2D6*10 with CYP2D7P. Also, we found that most of the *10B-harboring haplotypes have the upstream *36 gene and that the majority of the remaining haplotypes are the single-type *10B. Haplotype frequencies of the single-type *10 and *36-*10B were 0.06 and 0.30, respectively, in the subjects analyzed. Additionally, several novel single nucleotide polymorphisms (SNPs) were found in the *36 region and several *36 haplotypes were identified. This sequence information is an important addition to the CYP2D6 sequence data that was obtained by the human genome project. [Abstract/Link to Full Text]

Saito M, Okutomi T, Shimizu M, Matsumoto Y, Yamazaki H, Hoka S
Activities of rat cytochrome P450 3A and 2C isoforms are increased in vivo by magnesium sulfate as evidenced by enhanced oxidation of bupivacaine and testosterone in liver microsomes.
Drug Metab Pharmacokinet. 2006 Jun;21(3):201-7.
We previously reported that magnesium sulfate (MgSO(4)) increases the threshold dose of bupivacaine in inducing seizure in rats. Cytochrome P450 (P450) isoforms involved in the biotransformation of bupivacaine to three oxidative metabolites and the effects of MgSO(4) in vivo on the P450 activities in rats were investigated. Of six cDNA-expressed rat P450 isoforms tested, CYP3A2 and CYP2C11 had high rates for N-debutlylation and 3'-hydroxylation of bupivacaine, respectively. The liver microsomes prepared from male rats pretreated with intravenous administration of MgSO(4) (a bolus dose of 25 mg/kg, followed by infusion of 2.0 mg/kg/min for 6 h) showed increased V(max) values for N-debutylation and 3'-hydroxylaiton of bupivacaine compared to the liver microsomes from control rats. Administration of MgSO(4) also increased the activities of testosterone 6beta- and 16alpha-hydroxylation. Although the level of expression of CYP3A and CYP2C isoforms in the liver microsomes were unchanged, NADPH-P450 reductase and cytochrome b(5) were found to be induced by intravenous administration of MgSO(4). These results suggest that CYP3A and CYP2C isoforms are activated by MgSO(4) in vivo as a consequence of enhanced microsomal electron transfer due to induction of NADPH-P450 reductase and cytochrome b(5), leading to the increased metabolism and clearance of bupivacaine. [Abstract/Link to Full Text]

Markova S, Nakamura T, Sakaeda T, Makimoto H, Uchiyama H, Okamura N, Okumura K
Genotype-dependent down-regulation of gene expression and function of MDR1 in human peripheral blood mononuclear cells under acute inflammation.
Drug Metab Pharmacokinet. 2006 Jun;21(3):194-200.
Recent advances in pharmacogenomics have suggested the association of clinical outcome of glucocorticoid-based anti-inflammatory therapy with a single nucleotide polymorphism at position 3435 in exon 26 (C3435T) of the MDR1 gene. In the present study, the effects of the MDR1 C3435T genotype on the time-dependent profiles of gene expression and function of MDR1/P-glycoprotein were evaluated in peripheral blood mononuclear cells (PBMCs) under lipopolysaccharide (LPS)-induced experimental acute inflammation. LPS treatment resulted in the rapid elevation of IL-1beta and TNF-alpha mRNA levels relative to beta-actin mRNA at 1 h, with a subsequent slight decrease at 3 h after the treatment, while the down-regulation of the relative concentration of MDR1 mRNA was found at 3 h, not at 1 h, after LPS treatment. Here, the C3435T genotype-dependent down-regulations of MDR1 mRNA level were found for CC(3435) and CT(3435), but not for TT(3435), and were 64.1+/-10.1%, 71.4+/-5.9% and 100.0+/-22.5% (+/-S.D.), respectively, of their respective baseline levels, which were independent of C3435T (0.010+/-0.005, 0.011+/-0.013 and 0.009+/-0.006 (+/-S.D.), respectively). The C3435T genotype-dependent down-regulation was supported by the increase of the intracellular accumulation of calcein in PBMCs treated with LPS for 72 h, and the increase was more predominant for CC(3435) than TT(3435). These data suggested that glucocorticoid-based anti-inflammatory therapy might be more effective for C(3435)-allele carriers than non-carriers. [Abstract/Link to Full Text]

Nagai J, Taogoshi T, Tokunaga A, Nishikawa H, Murakami T, Takano M
Characterization of prostaglandin E1 transport in rat renal brush-border membrane.
Drug Metab Pharmacokinet. 2006 Jun;21(3):186-93.
Transport of prostaglandin E(1) (PGE(1)) was investigated in rat renal brush-border membrane vesicles. The uptake of [(3)H]PGE(1) was sensitive to osmosis and temperature. This uptake was saturable and mediated by high-affinity (K(m)=2.1 microM)/low-capacity (V(max)=17.4 pmol/mg protein/30 sec) and low-affinity (K(m)=526.5 microM)/high-capacity (V(max)=1,032.5 pmol/mg protein/30 sec) transport systems. [(3)H]PGE(1) uptake was Na(+)-independent and inhibited by various eicosanoids including PGE(2) and PGF(2alpha). Bromcresol green and sulfobromophthalein, potent inhibitors of prostaglandin transporter (PGT), significantly decreased [(3)H]PGE(1) uptake. Uptake was also inhibited by indomethacin and probenecid, which reportedly have little effect on PGT. Benzylpenicillin and taurocholate decreased the uptake of [(3)H]PGE(1). Like p-[(14)C]aminohippurate (PAH) uptake by vesicles, the uptake of [(3)H]PGE(1) was stimulated by an inside-positive membrane potential, created by applying an inward K(+) gradient and valinomycin. However, the uptake of [(3)H]PGE(1) was not inhibited by PAH, suggesting that PAH and PGE(1) are transported by separate transport systems. [(3)H]PGE(1) uptake was not stimulated by outwardly directed gradients of Cl(-) nor unlabeled PGE(1), indicating that an anion exchanger may not be involved in PGE(1) transport. These findings suggest that the transport of PGE(1) in rat renal brush-border membrane is mediated by specific transport system(s), at least in part, by a potential-sensitive transport system. [Abstract/Link to Full Text]

Recent Articles in Journal of Pharmacological Sciences

Tanabe M, Takeuchi Y, Ono H
The supraspinally mediated analgesic effects of zonisamide in mice after peripheral nerve injury are independent of the descending monoaminergic system.
J Pharmacol Sci. 2007 Aug;104(4):335-40.
We have previously demonstrated that the antiepileptic drug zonisamide supraspinally generates analgesic effects on thermal and mechanical hypersensitivity in mice after peripheral nerve injury. To further establish the neurochemical basis for the supraspinally mediated analgesic action of zonisamide, we measured spinal noradrenaline (NA), 3-methoxy-4-hydroxyphenyleneglycol (MHPG), serotonin (5-HT), 5-hydroxyindoleacetic acid (5-HIAA), and dopamine (DA) contents using HPLC with electrochemical detection in a murine neuropathic pain model that was prepared by partial ligation of the sciatic nerve (Seltzer model). Intraperitoneally or intracerebroventricularly administered zonisamide (50 mg/kg, i.p. and 30 mug, i.c.v., respectively), which almost completely reduced mechanical hypersensitivity, did not elicit any changes in spinal NA, MHPG, 5-HT, 5-HIAA, and DA contents. Moreover, the effectiveness of i.p. or i.c.v. administered zonisamide at reducing thermal and mechanical hypersensitivity was not influenced by intrathecally administered yohimbine (3 mug), an alpha(2)-adrenergic receptor antagonist. Thus, it appears that the supraspinally mediated analgesic effects of zonisamide are independent of the descending monoaminergic pain inhibitory system. [Abstract/Link to Full Text]

Retraction: Pharmacokinetic interaction of paeoniflorin and sinomenine: pharmacokinetic parameters and tissue distribution characteristics in rats and protein binding ability in vitro.
J Pharmacol Sci. 2007 Jul;104(3):283. [Abstract/Link to Full Text]

Liu ZQ, Jiang ZH, Chan K, Zhou H, Wong YF, Bian ZX, Xu HX, Liu L
Pharmacokinetic interaction of paeoniflorin and sinomenine: pharmacokinetic parameters and tissue distribution characteristics in rats and protein binding ability in vitro.
J Pharmacol Sci. 2005 Dec;99(4):381-91.
The root of Paeonia lactiflora and the stem of Sinomenium acutum are two herbs widely used in Chinese herbal medicine for the treatment of inflammatory and arthritic diseases. Studies on the interaction of the active constituents of these herbs, i.e., paeoniflorin and sinomenine, in pharmacokinetic parameters, tissues distribution, and protein binding ability could provide empirical data to support their clinical application. Following oral administration to rats, the pharmacokinetic alterations were compared. The results showed that the pharmacokinetic parameters (Cmax, Tmax, AUC, MRT, C(L), and Vd) of paeoniflorin were markedly enhanced when co-administrated with sinomenine. At 45 min after oral administration, the concentrations of paeoniflorin in the main internal organs were significantly increased when co-administrated with sinomenine. These phenomena were not ascribable to the alteration of the protein binding ability of paeoniflorin by sinomenine because obvious interactions of paeoniflorin and sinomenine in protein binding abilities in vitro to rat and rabbit plasma, human albumin, and alpha-1-acid-glycoprotein were not observed. However, with respect to the in vivo influence of paeoniflorin on sinomenine, the results showed that co-administration of paeoniflorin did not affect the pharmacokinetic parameters and tissue distribution of sinomenine. [Abstract/Link to Full Text]

Hirata T, Keto Y, Funatsu T, Akuzawa S, Sasamata M
Evaluation of the pharmacological profile of ramosetron, a novel therapeutic agent for irritable bowel syndrome.
J Pharmacol Sci. 2007 Jul;104(3):263-73.
We examined the pharmacological profile of ramosetron, a 5-HT(3)-receptor antagonist for irritable bowel syndrome with diarrhea, comparing it with those of other 5-HT(3)-receptor antagonists, alosetron and cilansetron, and the anti-diarrheal agent loperamide. Ramosetron showed high affinity for cloned human and rat 5-HT(3) receptors, with K(i) values of 0.091 +/- 0.014 and 0.22 +/- 0.051 nmol/L, respectively, while its affinities for other receptors, transporters, ion channels, and enzymes were negligible. Dissociation of ramosetron from the human 5-HT(3) receptor was extremely slow (t(1/2) = 560 min), while alosetron (t(1/2) = 180 min) and cilansetron (t(1/2) = 88 min) dissociated relatively rapidly. Ramosetron competitively inhibited 5-HT-induced contraction of isolated guinea-pig colon, with pA(2) values of 8.6 (8.5 - 9.0). Ramosetron given orally also dose-dependently inhibited the von Bezold-Jarisch reflex in rats, with an ED(50) value of 1.2 (0.93 - 1.6) microg/kg. In addition, oral ramosetron dose-dependently inhibited restraint stress-induced defecation in rats, with an ED(50) value of 0.62 (0.17 - 1.2) microg/kg. In all of these experiments, the potencies of ramosetron were greater than those of alosetron, cilansetron, or loperamide. These results indicate that ramosetron is a highly potent and selective 5-HT(3)-receptor antagonist, with beneficial effects against stress-induced abnormal defecation in rats. [Abstract/Link to Full Text]

Sharifi AM, Mousavi SH, Farhadi M, Larijani B
Study of high glucose-induced apoptosis in PC12 cells: role of bax protein.
J Pharmacol Sci. 2007 Jul;104(3):258-62.
Hyperglycemia, which occurs under the diabetic condition, induces serious diabetic complications. Diabetic neuropathies, affecting the autonomic, sensory, and motor peripheral nervous system, are among the most frequent complications of diabetes. Little is known about the direct toxic effect of high glucose concentrations on neuronal cells. Therefore in the present study, glucose-induced toxicity was studied in PC12 cells as an in vitro cellular model for diabetic neuropathy using the MTT assay. The possible role of apoptosis was also investigated in this toxicity. The result showed that a 3-fold increase in optimum glucose concentration for PC12 cells (13.5 mg/ml) significantly reduced cell viability after 48 h. In Western blot analysis, the ratio of Bax/Bcl-2 protein expression in cells treated with high glucose was significantly increased compared to controls. Additionally high glucose could induce a DNA ladder pattern in PC12 cells, a hallmark of apoptosis indicating nuclear fragmentation. From our present results, it may be concluded that high glucose can cause PC12 cell death, in which apoptosis plays an important role possibly by the mitochondrial pathway through higher expression of Bax pro-apoptotic protein. [Abstract/Link to Full Text]

Low B, Liang M, Fu J
p38 mitogen-activated protein kinase mediates sidestream cigarette smoke-induced endothelial permeability.
J Pharmacol Sci. 2007 Jul;104(3):225-31.
Second-hand smoke is associated with increased risk of cardiovascular diseases. So far, little is known about the signaling mechanisms of second-hand smoke-induced vascular dysfunction. Endothelial junctions are fundamental structures important for maintaining endothelial barrier function. Our study showed that sidestream cigarette smoke (SCS), a major component of second-hand smoke, was able to disrupt endothelial junctions and increase endothelial permeability. Sidestream cigarette smoke stimulated the phosphorylation of p38 mitogen-activated protein kinase (MAPK) and myosin light chain (MLC). A selective inhibitor of p38 MAPK (SB203580) prevented SCS-induced loss of endothelial barrier integrity as evidenced by transendothelial resistance measurements. Resveratrol, an antioxidant that was able to inhibit SCS-induced p38 MAPK and MLC phosphorylation, also protected endothelial cells from the damage. Thus, p38 MAPK mediates SCS-induced endothelial permeability. Inhibition of p38 MAPK may have therapeutic potential for second-hand smoke-induced vascular injury. [Abstract/Link to Full Text]

Husna B, On T, Zhu YZ
Effects of purified Salvia miltiorrhiza extract on cardiac vascular smooth muscle hypoxic cells.
J Pharmacol Sci. 2007 Jul;104(3):202-11.
Recently, we have reported that purified Salvia miltiorrhiza extract (PSME) could prevent myocardial infarction in vivo and myocardial ischemia/reperfusion injury in isolated rat hearts (ex vivo). The aim of this project is to determine whether PSME exerts any cardioprotective effects in vitro. The vascular smooth muscle cell line was used and the effects of the drugs were determined after inducing hypoxia. Gene expression levels of the pro-apoptotic genes Asp53, Bax, and Fas were significantly down-regulated by 0.78-, 0.82-, and 0.87-fold, respectively, and Bcl-2 was up-regulated by 0.82-fold in the PSME-treated groups as compared to the hypoxic group (P<0.05). Significant reduction in immunoreactivity of the protein products of these genes as well as least nuclear green fluorescence observed in TUNEL staining indicate the therapeutic potential of this drug. Furthermore, cardiac antioxidant enzymes assay confirmed this deduction as PSME had slight preserving effects on superoxide dismutase and catalase (0.25 +/- 0.01 vs 0.488 +/- 0.02 units/mg protein and 0.026 +/- 0.012 vs 0.076 +/- 0.01 mumol per min per mg protein, respectively; each P<0.05). No significant results were obtained with glutathione S-transferase and GSH peroxidase antioxidant tests. Our results demonstrated that PSME exerts antioxidant effects in vitro, indicating the therapeutic potential of this drug. [Abstract/Link to Full Text]

Takeba Y, Kumai T, Matsumoto N, Nakaya S, Tsuzuki Y, Yanagida Y, Kobayashi S
Irinotecan activates p53 with its active metabolite, resulting in human hepatocellular carcinoma apoptosis.
J Pharmacol Sci. 2007 Jul;104(3):232-42.
The topoisomerase I inhibitor irinotecan is widely used in anticancer therapy, although the detailed mechanism is still unclear. We investigated the apoptotic mechanisms of irinotecan in human hepatocellular carcinoma (HCC) cell lines (Huh7). SN-38 caused a significant decrease in cell proliferation and induced apoptosis in Huh7 cells and HepG2 cells. SN-38 significantly increased the expression of p53 protein and its phosphorylation at Ser(15) in the nucleus and apoptosis-inducing proteins Bax, caspase-9, and caspase-3, while it significantly decreased the antiapoptosis protein Bcl-xL of Huh7 cells. SN-38-induced apoptosis was recovered after p53 antisense oligodeoxynucleotide (AS ODN) pretreatment, while Huh7 cells were precultured with p53 AS ODN, followed by the addition of SN-38 for 24 h. Furthermore, increases in p53 DNA-binding activity were observed in the nuclei of Huh7 cells after SN-38 treatment as shown by electrophoretic mobility shift analysis. SN-38 binding motifs were detected in the proximal promoter of p53 (bases -433 to -317 and -814 to -711). These results suggest that the p53-mediated apoptosis pathway is important in the anticancer effects of irinotecan in hepatocellular carcinoma. [Abstract/Link to Full Text]

Fujii M, Akita K, Mizutani N, Nabe T, Kohno S
Development of numerous nerve fibers in the epidermis of hairless mice with atopic dermatitis-like pruritic skin inflammation.
J Pharmacol Sci. 2007 Jul;104(3):243-51.
Itching is the most important symptom in atopic dermatitis because the persistent scratching in response to itching aggravates the disease. However, the etiologic mechanisms of itching in atopic dermatitis remain uncertain. HR-1 hairless mice fed a special diet, HR-AD, develop atopic dermatitis-like symptoms with prolonged scratching episodes. The purpose of this study was to examine whether skin nerve fiber changes were involved in the prolonged scratching seen in this mouse model. On day 56 after the start of feeding, prolonged scratching, as well as atopic dermatitis-like skin changes, were clearly observed in HR-AD-fed mice, while no abnormal changes were observed in mice fed a normal diet. Immunohistochemical analyses of the skin using antibody to protein gene product 9.5 showed the development of numerous immunoreactive nerve fibers in the epidermis of HR-AD-fed mice. Furthermore, after cessation of HR-AD feeding, the reduction in intraepidermal nerve fibers coincided with decreased scratching. Neither the prolongation of scratching nor the increase in intraepidermal nerve fibers was affected by dexamethasone treatment. Thus, the increased number of intraepidermal nerve fibers could be involved in the aggravation of itch-related scratching observed in this model. [Abstract/Link to Full Text]

Muntasir HA, Hossain M, Bhuiyan MA, Komiyama T, Nakamura T, Ozaki M, Nagatomo T
Identification of a key amino acid of the human 5-HT(2B) serotonin receptor important for sarpogrelate binding.
J Pharmacol Sci. 2007 Jul;104(3):274-7.
Based on radio-ligand binding and molecular modeling studies, sarpogrelate shows a moderate selectivity for 5-HT(2B) versus 5-HT(2A) receptors. To confirm the modeling data of sarpogrelate to 5-HT(2B) receptors predicting interaction of sarpogrelate towards Asp135 in helix 3 of 5-HT(2B) receptors, we constructed and characterized the mutation of this residue by site-directed mutagenesis. The Asp135Ala mutant did not exhibit any affinity for [(3)H]rauwolscine. Therefore, it was not possible to find sarpogrelate affinity to the mutant using [(3)H]rauwolscine. The mutation also abolished agonist-stimulated inositol phosphates formation. These results provide evidence that Asp135 is important for the interaction between 5-HT(2B) receptors and sarpogrelate. [Abstract/Link to Full Text]

Kanno S, Kakuta M, Kitajima Y, Osanai Y, Kurauchi K, Ohtake T, Ujibe M, Uwai K, Takeshita M, Ishikawa M
Inhibitory effect of trimidox on lipopolysaccharide-induced nitric oxide production in RAW 264.7 macrophages.
J Pharmacol Sci. 2007 Jul;104(3):278-81.
We examined the effect of trimidox (3,4,5-trihydroxybenzamidoxime) on the production of nitric oxide (NO) by lipopolysaccharide (LPS) in mouse RAW 264.7 macrophages. Trimidox (50 - 300 microM) concentration-dependently inhibited NO production by LPS (0.01, 0.1, or 1 microg/ml) after incubation for 24 h. LPS-induced expression of inducible NO synthase (iNOS) and degradation of IkappaBalpha were prevented by trimidox. The protective effect against NO production by LPS was not only observed in prior incubation but also later incubation with trimidox until iNOS was activated by LPS. These results suggest that trimidox has a predominantly protective effect against LPS-induced production of NO via iNOS expression. [Abstract/Link to Full Text]

Filaretova L, Podvigina T, Bagaeva T, Bobryshev P, Takeuchi K
Gastroprotective role of glucocorticoid hormones.
J Pharmacol Sci. 2007 Jul;104(3):195-201.
Gastric ulcer disease remains widespread; a stressful lifestyle and nonsteroidal antiinflammatory drugs (NSAIDs) make significant contributions to this pathological situation. The findings overviewed here support the idea that glucocorticoid hormones released in response to acute stress or NSAIDs act as gastroprotective substances and exert many of the same actions in the stomach as prostaglandins (PGs) and nitric oxide (NO) as well as capsaicin-sensitive afferent neurons. Glucocorticoids exert a gastroprotective effect by both maintaining local defensive factors (mucosal blood flow and mucus production) and inhibiting pathogenic elements (gastric motility and microvascular permeability). Furthermore, they exert gastroprotective actions in co-operation with PGs, NO, and the afferent neurons; and their compensatory action is observed when the protective mechanism provided by either of these factors is impaired. The gastroprotective action of glucocorticoids is also associated with maintenance of general body homeostasis, including blood glucose levels and systemic blood pressure. In conclusion, glucocorticoids released in response to acute stress or NSAIDs are naturally occurring protective factors that play an important role in maintenance of the gastric mucosal integrity. This led us to re-evaluate the traditional paradigm that glucocorticoid hormones produced during activation of the hypothalamic-pituitary-adrenocortical axis are ulcerogenic in the stomach. [Abstract/Link to Full Text]

Takano H, Liu W, Zhao Z, Cui S, Zhang W, Shibamoto T
N(G)-nitro-L-arginine methyl ester, but not methylene blue, attenuates anaphylactic hypotension in anesthetized mice.
J Pharmacol Sci. 2007 Jul;104(3):212-7.
To clarify the role of NO in mouse anaphylactic hypotension, effects of a nitric oxide (NO) synthase inhibitor, N(G)-nitro-L-arginine methyl ester (L-NAME), on antigen-induced hypotension and portal hypertension were determined in anesthetized BALB/c mice. Systemic arterial pressure (Psa), central venous pressure (Pcv), and portal venous pressure (Ppv) were directly and simultaneously measured. Mice were first sensitized with ovalbumin, and then the injection of antigen was used to decrease Psa and increase Ppv. Pretreatment with L-NAME (1 mg/kg) attenuated this antigen-induced systemic hypotension, but not the increase in Ppv. The effect of inhibitors of soluble guanylate cyclase on anaphylactic hypotension were studied with either methylene blue (3.0 mg/kg) or 1H-[1,2,4]oxadiazole[4,3-a]quinoxalin-1-one (10 mg/kg). Neither modulated any antigen-induced changes. Furthermore, methylene blue did not improve systemic hypotension induced by Compound 48/80 (4.5 mg/kg), a mast cell degranulator, which can produce non-immunological anaphylactoid reactions. These data show in anesthetized BALB/c mice that L-NAME attenuated anaphylactic hypotension without affecting portal hypertension. This beneficial effect of L-NAME appears not to depend on the soluble guanylate cyclase pathway. [Abstract/Link to Full Text]

Sasaki A, Nakashima Y, Takasaki I, Andoh T, Shiraki K, Kuraishi Y
Effects of loperamide on mechanical allodynia induced by herpes simplex virus type-1 in mice.
J Pharmacol Sci. 2007 Jul;104(3):218-24.
In the present study, we investigated whether the peripherally acting micro-opioid receptor agonist loperamide would inhibit allodynia in the non-inflamed dermatome of mice with herpetic pain. Subcutaneous (s.c.) injection of loperamide (1 and 3 mg/kg) inhibited allodynia. Local (intraplantar) injection of loperamide (1 and 5 microg/site) also produced an anti-allodynic effect. The peripheral opioid receptor antagonist naloxone methiodide (0.1 mg/kg, s.c.) and the micro-opioid receptor-selective antagonist beta-funaltrexamine (40 nmol/site, intraplantar and 20 mg /kg, s.c.) antagonized the anti-allodynic effects of systemic and local loperamide. Local injection of loperamide into the contralateral hind paw was without effect, suggesting that the effect is mediated through local action, not systemic action. Acute and subacute tolerance did not develop to the anti-allodynic effect of loperamide. In addition, there were no cross-tolerance between local opioids (morphine and loperamide) and systemic morphine. These results suggest that stimulation of peripheral micro-opioid receptors suppresses herpetic allodynia without tolerance development. The non-narcotic micro-opioid receptor agonist loperamide may relieve acute herpetic pain in patients with herpes zoster. [Abstract/Link to Full Text]

Yamamoto Y, Mikami A, Fujii Y, Kamei C
Effect of histamine on muscimol-induced working memory deficits in radial maze performance.
J Pharmacol Sci. 2007 Jul;104(3):252-7.
We investigated the participation of gamma-aminobutyric acid (GABA) neurons of the medial septal area in eight-arm radial maze performance in rats. The intra-septal injection of muscimol, a GABA(A) agonist, caused an increase in total error and working memory error. On the other hand, no significant effect was observed with reference memory error. Donepezil and tacrine (cholinesterase inhibitors) antagonized the muscimol-induced spatial memory deficits. Histidine (1500 mg/kg, i.p.) also improved the total error and working memory error induced by muscimol. At this dose, histidine caused a significant increase in the histamine content of the cortex, hippocampus, and hypothalamus in rats. In addition, the intra-hippocampal injection of histamine also antagonized muscimol-induced spatial memory deficits. The practical conclusion is that the GABA(A) receptor of the medial septal area plays an important role in working memory, and also, the disturbance of working memory induced by muscimol is mediated not only by cholinergic but also by histaminergic systems in the spatial memory of rats. [Abstract/Link to Full Text]

Shirato K, Tanihata J, Motohashi N, Tachiyashiki K, Tomoda A, Imaizumi K
Beta2-agonist clenbuterol induced changes in the distribution of white blood cells in rats.
J Pharmacol Sci. 2007 Jun;104(2):146-52.
Clenbuterol [CLE: 4-amino-alpha(t-butyl-amino)methyl-3,5-dichlorobenzyl alcohol] is well known as a potent beta2-adrenergic agonist and non-steroidal anabolic drug, and thus it is generally used for sports doping and asthma therapy. Although the functions of immune cells such as white blood cells (WBCs) have shown to be modulated through beta2-adrenoceptors, the effects of CLE on immune-responsive systems have not been elucidated systematically. Therefore, the effects of CLE on the number of WBCs were studied in rats. Male adult rats were divided into CLE-administered group and the control group to compare the number of total WBCs, neutrophils, monocytes, lymphocytes, eosinophils, and basophils. The administration (dose = 1.0 mg . kg(-1) body weight . day(-1), s.c.) of CLE was maintained for 30 days. CLE did not change the number of total WBCs during the experimental period. However, CLE increased significantly the number of neutrophils and monocytes, while CLE decreased drastically the number of lymphocytes and eosinophils. There was no significant change in the number of basophils between both groups. These results suggest that the administration of CLE induces drastic redistribution of WBCs in circulation without changing the number of total WBCs, and these responses of WBCs during the administration of CLE are sustained for at least 30 days. [Abstract/Link to Full Text]

Fukazawa Y, Maeda T, Kiguchi N, Tohya K, Kimura M, Kishioka S
Activation of spinal cholecystokinin and neurokinin-1 receptors is associated with the attenuation of intrathecal morphine analgesia following electroacupuncture stimulation in rats.
J Pharmacol Sci. 2007 Jun;104(2):159-66.
We previously demonstrated that electroacupuncture (EA) stimulation both produced antinociception and attenuated intrathecal (i.t.) morphine analgesia, suggesting that EA is capable of inducing two opposing systems, that is, opioid and anti-opioid mechanisms. This study examined the involvement of cholecystokinin (CCK) in the anti-opioid effects following EA in the spinal cord. EA was applied to commonly used acupoints for antinociception, ST-36 located 5-mm lateral to the anterior tubercle of the tibia, and analgesia was assessed by the hind-paw pressure test in male Sprague-Dawley rats. I.t. administration of CCK (0.01 - 10 microg) attenuated i.t. morphine analgesia (10 microg) dose-dependently. The attenuation of morphine analgesia following EA was reversed by i.t. proglumide, a CCK-receptor antagonist (0.01 microg). CCK-like immunoreactivity was increased in lamina I and II in the dorsal horn, and expression of spinal CCK mRNA increased after EA. Moreover, i.t. pretreatment with the neurokinin-1 (NK1)-receptor antagonist L-703,606 (18 microg) reversed both EA- and CCK-induced attenuation of morphine analgesia. These results suggest that CCK-mediated neural systems in the spinal cord may be involved in the attenuation of morphine analgesia following EA and that substance P-induced activation of NK1 receptors may be responsible for the downstream neuronal transmission of the CCK-mediated neuronal system. [Abstract/Link to Full Text]

Kitagawa Y, Tamura Y, Shimizu J, Nakajima-Takenaka C, Taniguchi S, Uesato S, Takaki M
Effects of a novel histone deacetylase inhibitor, N-(2-aminophenyl) benzamide, on a reversible hypertrophy induced by isoproterenol in in situ rat hearts.
J Pharmacol Sci. 2007 Jun;104(2):167-75.
The aim of the present study was performed to determine whether a novel histone deacetylase (HDAC) inhibitor, N-(2-aminophenyl)-4-{[benzyl(2-hydroxyethyl)amino]methyl} benzamide (K-183), prevents a reversible cardiac hypertrophy induced by isoproterenol and improves left ventricular (LV) dysfunction in rats. Either isoproterenol or vehicle was infused for 3 days by osmotic minipump. One hour prior to the implantation of isoproterenol, K-183 or trichostatin A (TSA) was injected twice a day for 3 days. We recorded continuous LV pressure-volume (P-V) loops of in situ hearts one hour after removal of the osmotic minipump. LV work capability (systolic P-V area at midrange LV volume: PVA(mLVV)) and hemodynamics were evaluated. K-183 per se induced neither cardiac hypertrophy nor collagen production. Although K-183 did not prevent the hypertrophy, where PVA(mLVV) remained decreased, K-183, differently from TSA, significantly attenuated the decrease of cardiac output and the increase of effective arterial elastance in the hypertrophied heart. These results indicate that the novel HDAC inhibitor K-183 has some beneficial effects on hemodynamics, although K-183 has no effects of anti-hypertrophic modalities. [Abstract/Link to Full Text]

Ferrer-Lorente R, Cabot C, Fern�ndez-L�pez JA, Alemany M
Effects of combined oleoyl-estrone and rimonabant on overweight rats.
J Pharmacol Sci. 2007 Jun;104(2):176-82.
Oleoyl-estrone (OE) decreases appetite, maintains energy expediture, induces lipolysis (sparing protein), and decreases cholesterolemia and insulin resistance. Rimonabant (SR141716) is a cannabinoid-receptor inhibitor that decreases appetite and mobilizes fat. We studied whether their combination improves their slimming effects. Male overweight rats received daily gavages of 5.3 mg/kg OE, 10 mg/kg rimonabant, or both drugs during 10 days. Body weight and composition, energy balance, adipose tissue weight, and serum hormones and metabolites were measured. OE halved food intake and maintained energy expenditure at the expense of body fat. Rimonabant effects on appetite and energy balance were less marked, resulting in lower lipid mobilization. OE and rimonabant followed the OE pattern, with no additive or synergic effects. Glycemia was maintained, but OE decreased insulin, GLP-1, and cholesterol, whilst rimonabant increased cholecystokinin and cholesterol, and decreased NEFA. Both drugs decreased leptin and triacylglycerols; ghrelin was unchanged. The results hint at different mechanisms of action of both drugs: we can assume that OE effects do not involve the cannabinoid pathway. OE does not seem to act, either, after 10 days, through the secretion of ghrelin or the intestinal appetite-controlling peptides tested. [Abstract/Link to Full Text]

Takahashi HK, Kanke T, Liu K, Yoshino T, Sendo T, Tanaka N, Nishibori M
Adenosine A2A-receptor stimulation inhibits lipopolysaccharide-induced interleukin-18 production in monocytes.
J Pharmacol Sci. 2007 Jun;104(2):183-6.
Adenosine inhibited interleukin (IL)-18 production in lipopolysaccharide (LPS)-stimulated monocytes. The action of adenosine was antagonized by an adenosine A2A-receptor (A2AR) antagonist and was mimicked by an A2AR agonist, suggesting that the stimulation of A2AR may be involved in the actions of adenosine. On the other hand, the stimulation of A1R and A3R inhibited the actions of A2AR stimulation, whereas the stimulation of A2BR had no effect on them. Activation of A2AR is known to increase cyclic adenosine monophosphate (cAMP) levels and to activate protein kinase A (PKA). A PKA inhibitor prevented the actions of A2AR stimulation, indicating that the action mechanism of A2AR stimulation may be via the activation of the cAMP/PKA pathway. [Abstract/Link to Full Text]

Moriyasu S, Yamamoto K, Kureyama N, Okamura K, Ikeda T, Yamatodani A
Involvement of histamine released from mast cells in acute radiation dermatitis in mice.
J Pharmacol Sci. 2007 Jun;104(2):187-90.
A possible involvement of histamine in acute radiation dermatitis in mice was investigated. The dose of 40 Gy of gamma irradiation induced erythema and edema in C57BL/6 mice treated with vehicle. However, in C57BL/6 mice treated with chlorpheniramine and WBB6F1-W/Wv mice, erythema and edema were not observed. In all of these mice, epilation and dry desquamation were induced, but bepotastine significantly reduced the extent of these areas. These results suggest that gamma irradiation-induced erythema and edema were caused by histamine released from mast cells via histamine H1 receptor, and epilation was induced by other inflammatory mediators. [Abstract/Link to Full Text]

Koyama R, Muramatsu R, Sasaki T, Kimura R, Ueyama C, Tamura M, Tamura N, Ichikawa J, Takahashi N, Usami A, Yamada MK, Matsuki N, Ikegaya Y
A low-cost method for brain slice cultures.
J Pharmacol Sci. 2007 Jun;104(2):191-4.
Low-cost, simple procedures for organotypic tissue cultures are desirable for high-throughput biological experiments such as large-scale medical/drug screening. We present a practical and economical method to cultivate brain slices using hydrophilic filtration membranes. With a cost reduction of more than 90%, this technique allows us to prepare hippocampal slice cultures that are morphologically and functionally indistinguishable from those obtained by the widely used Millicell-CM method. [Abstract/Link to Full Text]

Hirano K
Current topics in the regulatory mechanism underlying the Ca2+ sensitization of the contractile apparatus in vascular smooth muscle.
J Pharmacol Sci. 2007 Jun;104(2):109-15.
The Ca2+ signal is the primary determinant of the contraction of the vascular smooth muscle. However, the alteration of the Ca2+ sensitivity of the contractile apparatus also plays an essential role. The regulation of the myosin light chain phosphatase (MLCP) activity is considered to be the most important mechanism underlying the regulation of Ca2+ sensitivity. The investigations during the last 15 years have identified many proteins that participate in the regulation of the MLCP activity. Recently, the Ca2+ signal has also been shown to cross-talk with the mechanisms regulating the Ca2+ sensitivity. Consequently, Rho kinase, protein kinase C, CPI-17, and MYPT1 have all been suggested to play a physiologically important role in the regulation of the MLCP activity. We are now close to elucidating the major rules regulating the MLCP activity and the Ca2+ sensitivity during vascular contractions. This article will give an overview of the current understanding of the biochemical basis for the regulation of the MLCP activity, while also discussing their functional roles from a physiological point of view. I hope this article will help to develop new pharmacological strategies for the prevention and treatment of the pathological vasoconstriction often seen in vascular diseases. [Abstract/Link to Full Text]

Niwa M, Nitta A, Yamada K, Nabeshima T
The roles of glial cell line-derived neurotrophic factor, tumor necrosis factor-alpha, and an inducer of these factors in drug dependence.
J Pharmacol Sci. 2007 Jun;104(2):116-21.
There are few efficacious medications for drug dependence at present. Recent evidence has suggested that various cytokines are involved in the effects of abused drugs, suggesting that these factors play a role in drug dependence. In this article, the roles of glial cell line-derived neurotrophic factor (GDNF) and tumor necrosis factor-alpha (TNF-alpha) in drug dependence are discussed. GDNF inhibits the cocaine-induced upregulation of tyrosine hydroxylase activity in the ventral tegmental area and blocks behavioral responses to cocaine. TNF-alpha attenuates rewarding effects and locomotor sensitization induced by methamphetamine (METH) and morphine (MOR). Moreover, we mentioned the potential of Leu-Ile, which induces the expression of GDNF and TNF-alpha, as a novel therapeutic agent for drug dependence. Leu-Ile inhibits not only the development but also the maintenance of METH- or MOR-induced place preference and locomotor sensitization in mice. The inhibitory effect of Leu-Ile on METH- or MOR-induced place preference is not observed in GDNF heterozygous and TNF-alpha knockout mice. Leu-Ile inhibits METH- or MOR-induced place preference and sensitization by attenuating the METH- or MOR-induced increase in extracellular dopamine levels in the nucleus accumbens via the induction of GDNF and TNF-alpha expression. These findings suggest that Leu-Ile could be a novel therapeutic agent for drug dependence. [Abstract/Link to Full Text]

Stojnic N, Gojkovic-Bukarica L, Peric M, Grbovic L, Lesic A, Bumbasirevic M, Heinle H
Potassium channel opener pinacidil induces relaxation of the isolated human radial artery.
J Pharmacol Sci. 2007 Jun;104(2):122-9.
Taking into consideration that the search for drugs capable of modifying blood flow through human radial artery (RA) is warranted, the present study was designed to examine the vasodilatatory effects of the potassium channel opener, pinacidil on the RA and to define the contribution of different K+ -channel subtypes in the endothelium-independent pinacidil action on this blood vessel. Pinacidil relaxed the RA rings with endothelium and without endothelium with comparable potency. N-nitro-L-arginine methyl ester (L-NAME) and methylene blue did not affect the pinacidil-induced vasorelaxation in rings with endothelium. In the rings without endothelium, the K+ -channel blockers glibenclamide and tetraethylammonium (TEA) moderately antagonized the pinacidil-induced relaxation, while charybdotoxin and 4-aminopiridine did not. In endothelium-denuded rings, precontracted with 100 mM K+, the relaxant responses to pinacidil were highly significantly shifted to the right compared to those obtained in RA precontracted with phenylephrine, but pinacidil-induced maximal relaxation was not affected. Addition of nifedipine did not but addition of nifedipine and nickel (Na+ -Ca2+ exchanger inhibitor) did cause a statistically significant rightward shift of the pinacidil concentration-relaxation curve, although the effect 0.1 mM pinacidil was preserved. Thus, pinacidil induces relaxation of the human RA in endothelium-independent manner, and glibenclamide- and TEA-sensitive vascular smooth muscle K+ channels are probably involved. Its ability to completely relax the RA precontracted with K+ -rich solution suggests that pinacidil has additional K+ channel-independent mechanism(s) of action. It seems that stimulation of the forward mode of the Na+ -Ca2+ exchanger plays a part in this K+ channel-independent effect of pinacidil. [Abstract/Link to Full Text]

Kao CH, Kao TY, Huang WT, Lin MT
Lipopolysaccharide- and glutamate-induced hypothalamic hydroxyl radical elevation and fever can be suppressed by N-methyl-D-aspartate-receptor antagonists.
J Pharmacol Sci. 2007 Jun;104(2):130-6.
The purpose of the current study was to explore the effects of N-methyl-D-aspartate (NMDA)-receptor antagonists (MK-801 and LY235959) administered intracerebroventricularly on the changes of both core temperature and hypothalamic levels of 2,3-dihydroxybenzoic acid (2,3-DHBA) induced by intracerebroventricular injection of glutamate (100 - 400 microg at 10 microl/rabbit) or intravenous administration of lipopolysaccharide (LPS) (2 microg/kg) in rabbits. The measurements of 2,3-DHBA were used as an index of the intrahypothalamic levels of hydroxyl radicals. The rise in both the core temperature and hypothalamic 2,3-DHBA could be induced by intracerebroventricular injection of glutamate or intravenous administration of LPS. The glutamate- or LPS-induced fever and increased hypothalamic levels of 2,3-DHBA were significantly antagonized by pretreatment with injection of MK-801 or LY235959 1 h before glutamate or LPS injection. The increased levels of prostaglandin E2 in the hypothalamus induced by glutamate or LPS could be suppressed by MK-801 or LY235959. The data demonstrate that prior antagonism of NMDA receptors in the brain, in addition to reducing prostaglandin E2 production in the hypothalamus, suppresses both the glutamate- and LPS-induced fever and increased hypothalamic hydroxyl radicals. [Abstract/Link to Full Text]

Toyama T, Kudo N, Hibino Y, Mitsumoto A, Nishikawa M, Kawashima Y
Effects of pioglitazone on stearoyl-CoA desaturase in obese Zucker fa/fa rats.
J Pharmacol Sci. 2007 Jun;104(2):137-45.
The effects of a peroxisome proliferator activated receptor gamma (PPARgamma) agonist on hepatic stearoyl-CoA desaturase (SCD) in insulin-resistant and obese Zucker fa/fa rats were studied. The administration of pioglitazone, a PPARgamma agonist, to Zucker obese rats greatly improved their insulin sensitivity. The treatment of Zucker obese rats with pioglitazone did not affect the index of fatty acid desaturation of either serum or liver. Hepatic SCD activity and the mRNA level of SCD1 were not changed by treatment of the rats with pioglitazone. The activity of palmitoly-CoA chain elongase, which is involved in the biosynthesis of oleic acid in concert with SCD, was not significantly altered when Zucker obese rats received pioglitazone. Although neither the activity nor mRNA expression of acyl-CoA oxidase was changed by treatment of Zucker obese rats with pioglitazone, the mRNA expressions of both sterol regulatory element-binding protein-1c and acetyl-CoA carboxylase sensitively responded to the challenge by pioglitazone. These results suggest that the insulin sensitivity of insulin-resistant and obese Zucker fa/fa rats is improved by pioglitazone independently of SCD activity. [Abstract/Link to Full Text]

Ago Y, Takahashi K, Nakamura S, Hashimoto H, Baba A, Matsuda T
Anxiety-like and exploratory behaviors of isolation-reared mice in the staircase test.
J Pharmacol Sci. 2007 Jun;104(2):153-8.
The behavior of isolation-reared mice has not yet been studied in the staircase test. The present study examined the effects of anxiolytic or anxiogenic agents and isolation rearing on the behavior of ddY (outbred) strain mice in the staircase test. Diazepam and phenobarbital increased the number of steps climbed, but did not affect rearing behavior in group-reared mice. FG-7142, a benzodiazepine inverse agonist, significantly increased the number of rearing with no changes in the number of steps climbed in group-reared mice. Methamphetamine increased the number of steps climbed and decreased the number of rearing in group-reared mice. Although isolation-reared mice showed hyperactivity, there was no difference in locomotor activity for the test period of 3 min between isolation- and group-reared mice. Under these conditions, isolation rearing increased the numbers of steps climbed and rearing compared to group-reared controls. Microanalysis of locomotor patterns of group-reared mice in the staircase test showed that anxiolytic drugs increased the number of climbing to the top step of the staircase and methamphetamine increased the number of climbing to the first to third step. These results suggest that isolation rearing causes an anxiety-like state with increased exploratory behavior in mice. [Abstract/Link to Full Text]

Wang J, Shang F, Jiang R, Liu L, Wang S, Hou J, Huan M, Mei Q
Nitric oxide-donating genistein prodrug: design, synthesis, and bioactivity on MC3T3-E1 cells.
J Pharmacol Sci. 2007 May;104(1):82-9.
To find a more potent alternative with less estrogen-related side effects for hormone replacement therapy, we designed and synthesized a nitric oxide (NO)-releasing prodrug of genistein, named NO-donating genistein (NO-G). The characteristics of NO-G were determined by melting point, NMR spectroscopy, and mass spectrometric analysis. HPLC has been used to test the new prodrug's stability. The releasing capacity of NO-G was tested by Griess reagent in vitro. The bioactivities of NO-G on proliferation, differentiation, and mineralization of the osteoblastic cell line MC3T3-E1 were determined by MTT assay, flow cytometric analysis, measurement of the alkaline phosphatase (ALP) activity and the secreted osteocalcin (OCN), and Alizarin Red-S staining. The product showed 1H NMR spectra and relative molecular mass in agreement with the designed structure, and it was stable in buffer solution. NO-G continually released low level NO within 5 h in MC3T3-E1 cells. NO-G caused a significant elevation of cell growth, ALP activity, and OCN secretion in both dose- and time-dependent manner. Furthermore, the Alizarin Red-S staining showed that NO-G promoted mineralization of MC3T3-E1 cells. These effects were all significantly greater than those of its parent drugs. The results suggested that NO-G might be a novel drug for the treatment of postmenopausal osteoporosis. [Abstract/Link to Full Text]

Huang YY, Peng CH, Yang YP, Wu CC, Hsu WM, Wang HJ, Chan KH, Chou YP, Chen SJ, Chang YL
Desipramine activated Bcl-2 expression and inhibited lipopolysaccharide-induced apoptosis in hippocampus-derived adult neural stem cells.
J Pharmacol Sci. 2007 May;104(1):61-72.
Desipramine (DP) is a tricyclic antidepressant used for treating depression and numerous other psychiatric disorders. Recent studies have shown that DP can promote neurogenesis and improve the survival rate of hippocampal neurons. However, whether DP induces neuroprotection or promotes the differentiation of neural stem cells (NSCs) needs to be elucidated. In this study, we cultured NSCs derived from the hippocampal tissues of adult rats as an in vitro model to evaluate the modulation effect of DP on NSCs. First, we demonstrated that the expression of Bcl-2 mRNA and nestin in 2 microM DP-treated NSCs were up-regulated and detected by real-time reverse transcriptase polymerase chain reaction (RT-PCR). The results of Western blotting and immunofluorescent study confirmed that Bcl-2 protein expression was significantly increased in Day 3 DP-treated NSCs. Using the Bcl-2 small interfering RNA (siRNA) method, our results further showed that DP protects the lipopolysaccharide (LPS)-induced apoptosis in NSCs, in part by activating the expression of Bcl-2. Furthermore, DP treatment significantly inhibited the induction of proinflammatory factor interleukin (IL)-1beta, IL-6, and tumor necrosis factor-alpha in the culture medium of LPS-treated NSCs mediated by Bcl-2 modulation. The results of high performance liquid chromatography coupled to electrochemical detection further confirmed that DP significantly increased the functional production of serotonin (26+/-3.5 microM, DP-treated 96 h) and noradrenaline (50+/-8.9 microM, DP-treated 96 h) in NSCs through activation of the MAPK/ERK pathway and partially mediated by Bcl-2. In conclusion, the present results indicate that DP can increase neuroprotection ability by inhibiting the LPS-induced inflammatory process in NSCs via the modulation of Bcl-2 expression, as confirmed by the siRNA method. [Abstract/Link to Full Text]

Lee CW, Lee SH, Lee JW, Ban JO, Lee SY, Yoo HS, Jung JK, Moon DC, Oh KW, Hong JT
2-hydroxycinnamaldehyde inhibits SW620 colon cancer cell growth through AP-1 inactivation.
J Pharmacol Sci. 2007 May;104(1):19-28.
Cinnamaldehyde derivatives isolated from Cinnamomum cassia have been widely used for treating dyspepsia, gastritis, and inflammatory disease as well as cancer. To investigate the anti-tumor activities of several cinnamaldehyde derivatives, we compared the inhibitory effect of cinnamaldehyde derivatives on cell growth and AP-1 transcriptional activity in SW620 human colon cancer cells since AP-1 is a transcriptional factor implicated to control cancer cell growth. Among the derivatives, 2'-hydroxycinnamaldehyde (HCA) most significantly inhibited cancer cell growth and AP-1 transcriptional activity in a dose-dependent manner with an IC50 value of 12.5 and 9 microg/ml, respectively. In further studies on the mechanism, we found that consistent with the inhibitory effect on cell growth, HCA dose-dependently (0-20 microg/ml) inhibited DNA binding activity of AP-1 accompanied with down regulation of c-Jun and c-Fos expressions. HCA also induced apoptotic cell death as well as expression of the apoptosis-regulating gene caspase-3, but inhibited the anti-apoptosis regulating gene bcl-2 in a dose-dependent manner. These results suggested that HCA has the most potent inhibitory effect against human colon cancer cell growth, and AP-1 may be an important target of HCA. [Abstract/Link to Full Text]

Recent Articles in Alternative Medicine Review

L-theanine . Monograph.
Altern Med Rev. 2005 Jun;10(2):136-8. [Abstract/Link to Full Text]

Lutein and zeaxanthin. Monograph.
Altern Med Rev. 2005 Jun;10(2):128-35. [Abstract/Link to Full Text]

Singh BB, Udani J, Vinjamury SP, Der-Martirosian C, Gandhi S, Khorsan R, Nanjegowda D, Singh V
Safety and effectiveness of an L-lysine, zinc, and herbal-based product on the treatment of facial and circumoral herpes.
Altern Med Rev. 2005 Jun;10(2):123-7.
CONTEXT: L-lysine, an essential amino acid, inhibits normal replication of Herpes simplex virus (HSV), shortening the normal course and duration of the disease. This study was conducted to determine the effectiveness of a combination of L-lysine with botanicals and other nutrients in relieving the symptoms of facial and circumoral herpes. METHODS: This small pilot study was conducted using an outcome (open-label) model. Thirty male and female participants (15 in each group) meeting the inclusion/exclusion criteria were admitted to the study. The 10 outcome measures used to monitor the sores were tingling, itching, burning, tenderness, prickling, soreness, bump/swelling, small blister(s), oozing blister(s), and crusting, as well as before-and-after photographs of the lesion, and a daily diary. RESULTS: At the end of treatment the ointment produced full resolution in 40 percent of the participants by the third day and in 87 percent by the end of the sixth day. A cold sore episode may last up to 21 days without treatment. CONCLUSIONS: Overall data indicated significant improvement in participants by the sixth day of treatment for all but two participants. There were no adverse effects reported during this study. [Abstract/Link to Full Text]

Abel C, Busia K
An exploratory ethnobotanical study of the practice of herbal medicine by the Akan peoples of Ghana.
Altern Med Rev. 2005 Jun;10(2):112-22.
This exploratory ethnobotanical study took place in Kumasi, the capital city of the Asante, one of the Akan tribes. Data was collected using the multi-method approach of descriptive review, semi-structured interviews with traditional medical practitioners, and brief scientific review. Traditional Akan medicine is holistic and does not separate the physical world from the supernatural world. It is deeply rooted in traditional religion, with illness seen as a departure from the natural equilibrium. Traditional healers are either spiritually based or non-spiritually based. This study found the traditional knowledge of healing and use of medicinal plants is disseminated through generations by family members. However, the acquisition of academic qualifications is now a priority, and formal training is taking place in the workplace and a university. Techniques used in diagnosis and treatment consist of a fusion of traditional and biomedical methods. Treatment of hypertension was used as an example, with all practitioners recognizing hypertension's clinical signs and symptoms. Medicinal plants are predominantly wildcrafted and dispensed mainly by decoction, although prepared formulas are given. To prevent self-medication, patients are seen frequently. Scientific evidence validates the pharmacological actions of the medicinal plants. Public health care in Ghana is accessed by a cash and carry system that is only available to those who can afford it. Approximately 75 percent of the population depends on traditional medicine for primary health care. A national health insurance scheme was introduced in 2004, and it has been proposed that traditional medicine will be integrated into this new system. [Abstract/Link to Full Text]

Grant WB, Holick MF
Benefits and requirements of vitamin D for optimal health: a review.
Altern Med Rev. 2005 Jun;10(2):94-111.
Vitamin D sufficiency is required for optimal health. The conditions with strong evidence for a protective effect of vitamin D include several bone diseases, muscle weakness, more than a dozen types of internal cancers, multiple sclerosis, and type 1 diabetes mellitus. There is also weaker evidence for several other diseases and conditions. There are good reasons that vitamin D sufficiency be maintained during all stages of life, from fetal development to old age. Adequate calcium intake is also recommended. The current vitamin D requirements in the United States are based on protection against bone diseases. These guidelines are being revised upward in light of new findings, especially for soft-tissue health. The consensus of scientific understanding appears to be that vitamin D deficiency is reached for serum 25-hydroxyvitamin D (25OHD) levels less than 20 ng/mL (50 nmol/L), insufficiency in the range from 20-32 ng/mL, and sufficiency in the range from 33-80 ng/mL, with normal in sunny countries 54-90 ng/mL, and excess greater than 100 ng/mL. Solar ultraviolet-B (UVB) irradiation is the primary source of vitamin D for most people. In general, the health benefits accruing from moderate UV irradiation, without erythema or excess tanning, greatly outweigh the health risks, with skin pigmentation (melanin) providing much of the protection. In the absence of adequate solar UVB irradiation due to season, latitude, or lifestyle, vitamin D can be obtained from fortified food, oily fish, vitamin D supplements, and artificial sources of UVB radiation. [Abstract/Link to Full Text]

Roxas M
Plantar fasciitis: diagnosis and therapeutic considerations.
Altern Med Rev. 2005 Jun;10(2):83-93.
Plantar fasciitis is the most common cause of inferior heel pain. The pain and discomfort associated with this condition can have a dramatic impact on physical mobility. The etiology of this condition is not clearly understood and is probably multi-factorial in nature. Weight gain, occupation-related activity, anatomical variations, poor biomechanics, overexertion, and inadequate footwear are contributing factors. Although plantar fasciitis is generally regarded as a self-limited condition, it can take months to years to resolve, presenting a challenge for clinicians. Many treatment options are available that demonstrate variable levels of efficacy. Conservative therapies include rest and avoidance of potentially aggravating activities, stretching and strengthening exercises, orthotics, arch supports, and night splinting. Other considerations include use of anti-inflammatory agents, ultrasonic shockwave therapy, and, in the most extreme cases, surgery. This article reviews plantar fasciitis, presents the most effective treatment options currently available, and proposes nutritional considerations that may be beneficial in the management of this condition. [Abstract/Link to Full Text]

Czap A
Of death, drugs, recalls, and arrogance.
Altern Med Rev. 2005 Mar;10(1):2-4. [Abstract/Link to Full Text]

Monograph. Sambucus nigra (elderberry).
Altern Med Rev. 2005 Mar;10(1):51-4. [Abstract/Link to Full Text]

Monograph. L-carnitine.
Altern Med Rev. 2005 Mar;10(1):42-50. [Abstract/Link to Full Text]

Friel PN, Hinchcliffe C, Wright JV
Hormone replacement with estradiol: conventional oral doses result in excessive exposure to estrone.
Altern Med Rev. 2005 Mar;10(1):36-41.
BACKGROUND: There is a lack of consensus about the safety of estrogen replacement therapy, especially with regard to its impact on a woman's risk for breast cancer. Elevated urinary or serum estrone and estradiol concentrations in postmenopausal women are associated with a moderately elevated risk of breast cancer. METHODS: Twenty-four-hour urinary steroid hormone profiles, including the measurement of estrone, estradiol, and estriol, were conducted for 35 postmenopausal women receiving oral estradiol at doses from 0.025-2.0 mg/day. RESULTS: Urinary excretion of estradiol exceeded premenopausal reference range values in women taking estradiol at doses greater than 0.5 mg/day. Urinary estrone excretion exceeded premenopausal reference range values in women taking estradiol doses of 0.25 mg/day or higher. Literature data indicate serum estrone concentrations also markedly exceed premenopausal reference ranges when estradiol is administered orally at a dose of 1 mg/day. CONCLUSIONS: The previously recommended oral dose of estradiol (1-2 mg/day) results in urinary excretion of estrone at values 5-10 times the upper limit of the reference range for premenopausal women. Retrospective studies associating oral estradiol with increased risk of breast cancer may reflect overdose conditions. Based on current knowledge, a prudent dose ceiling for oral estradiol replacement therapy of 0.25 mg/day is proposed. [Abstract/Link to Full Text]

Plaza SM, Lamson DW
Vitamin K2 in bone metabolism and osteoporosis.
Altern Med Rev. 2005 Mar;10(1):24-35.
This article covers in vitro, in vivo, and human data on the positive effect of vitamin K2 on osteoporosis. Data is available on vitamin K2 for osteoporosis caused by a number of conditions, including postmenopausal osteoporosis, Parkinson's disease, biliary cirrhosis, stroke, and drug-induced osteoporosis. The activity of vitamin K2 involves both an increase in the bone-building process and a separate decrease in the bone-loss process. Vitamin K2 exerts a more powerful influence on bone than vitamin K1, and should be considered for prevention or treatment in those conditions known to contribute to osteoporosis. [Abstract/Link to Full Text]

B�ger RH, Ron ES
L-Arginine improves vascular function by overcoming deleterious effects of ADMA, a novel cardiovascular risk factor.
Altern Med Rev. 2005 Mar;10(1):14-23.
There is abundant evidence that the endothelium plays a crucial role in the maintenance of vascular tone and structure. One of the major endothelium-derived vasoactive mediators is nitric oxide (NO), an endogenous messenger molecule formed in healthy vascular endothelium from the amino acid precursor L-arginine. Endothelial dysfunction is caused by various cardiovascular risk factors, metabolic diseases, and systemic or local inflammation. One mechanism that explains the occurrence of endothelial dysfunction is the presence of elevated blood levels of asymmetric dimethylarginine (ADMA)--an L-arginine analogue that inhibits NO formation and thereby can impair vascular function. Supplementation with L-arginine has been shown to restore vascular function and to improve the clinical symptoms of various diseases associated with vascular dysfunction. [Abstract/Link to Full Text]

Miller AL
Epidemiology, etiology, and natural treatment of seasonal affective disorder.
Altern Med Rev. 2005 Mar;10(1):5-13.
There is much more seasonal difference in higher latitudes than in lower latitudes. In a significant portion of the population of the northern United States, the shorter days of fall and winter precipitate a syndrome that can consist of depression, fatigue, hypersomnolence, hyperphagia, carbohydrate craving, weight gain, and loss of libido. If these symptoms persist in the winter, abate as the days grow longer, and disappear in the summer, the diagnosis of seasonal affective disorder (SAD) can be made. Many hypotheses exist regarding the biochemical mechanisms behind the predisposition toward this disease, including circadian phase shifting, abnormal pineal melatonin secretion, and abnormal serotonin synthesis. Although the mechanism(s) behind this disease is not fully known, one treatment appears to address each of the theories. Light therapy is a natural, non-invasive, effective, well-researched method of treatment for SAD. Various light temperatures and times of administration of light therapy have been studied, and a combination of morning and evening exposure appears to offer the best efficacy. Other natural methods of treatment have been studied, including L-tryptophan, Hypericum perforatum (St. John's wort), and melatonin. [Abstract/Link to Full Text]

Czap A
Bursting the analytical bubble.
Altern Med Rev. 2004 Dec;9(4):353-9. [Abstract/Link to Full Text]

Monograph. Valeriana officinalis.
Altern Med Rev. 2004 Dec;9(4):438-41. [Abstract/Link to Full Text]

Monograph. Boron.
Altern Med Rev. 2004 Dec;9(4):434-7. [Abstract/Link to Full Text]

Monograph. Angelica sinensis.
Altern Med Rev. 2004 Dec;9(4):429-33. [Abstract/Link to Full Text]

Bunea R, El Farrah K, Deutsch L
Evaluation of the effects of Neptune Krill Oil on the clinical course of hyperlipidemia.
Altern Med Rev. 2004 Dec;9(4):420-8.
OBJECTIVE: To assess the effects of krill oil on blood lipids, specifically total cholesterol, triglycerides, low-density lipoprotein (LDL), and high-density lipoprotein (HDL). METHODS: A multi-center, three-month, prospective, randomized study followed by a three-month, controlled follow-up of patients treated with 1 g and 1.5 g krill oil daily. Patients with hyperlipidemia able to maintain a healthy diet and with blood cholesterol levels between 194 and 348 mg per dL were eligible for enrollment in the trial. A sample size of 120 patients (30 patients per group) was randomly assigned to one of four groups. Group A received krill oil at a body mass index (BMI)-dependent daily dosage of 2-3 g daily. Patients in Group B were given 1-1.5 g krill oil daily, and Group C was given fish oil containing 180 mg eicosapentaenoic acid (EPA) and 120 mg docosahexaenoic acid (DHA) per gram of oil at a dose of 3 g daily. Group D was given a placebo containing microcrystalline cellulose. The krill oil used in this study was Neptune Krill Oil, provided by Neptune Technologies and Bioresources, Laval, Quebec, Canada. OUTCOME MEASURES: Primary parameters tested (baseline and 90-day visit) were total blood cholesterol, triglycerides, LDL, HDL, and glucose. RESULTS: Krill oil 1-3 g per day (BMI-dependent) was found to be effective for the reduction of glucose, total cholesterol, triglycerides, LDL, and HDL, compared to both fish oil and placebo. CONCLUSIONS: The results of the present study demonstrate within high levels of confidence that krill oil is effective for the management of hyperlipidemia by significantly reducing total cholesterol, LDL, and triglycerides, and increasing HDL levels. At lower and equal doses, krill oil was significantly more effective than fish oil for the reduction of glucose, triglycerides, and LDL levels. [Abstract/Link to Full Text]

Ancuceanu RV, Istudor V
Pharmacologically active natural compounds for lung cancer.
Altern Med Rev. 2004 Dec;9(4):402-19.
This article consists of an analysis of the available scientific research on botanically derived compounds that have potential efficacy in the treatment of lung cancer. The mechanisms of activity reviewed include alkylating agents, topoisomerase poisons, DNA synthesis inhibitors, protein synthesis inhibitors, immunoceuticals, and lipoxygenase inhibitors. Selection criteria include: (1) products whose activity have at least minimal scientific confirmation - preclinical (in vitro, in vivo) or clinical; (2) products with a well-defined chemical composition; or (3) products with a well-known or scientifically plausible mechanism of activity. [Abstract/Link to Full Text]

Head K, Jurenka JS
Inflammatory bowel disease. Part II: Crohn's disease--pathophysiology and conventional and alternative treatment options.
Altern Med Rev. 2004 Dec;9(4):360-401.
Crohn's disease, a subcategory of inflammatory bowel disease, contributes to significant morbidity, particularly in industrialized nations. It can affect people of any age, but is more commonly diagnosed in adolescence and young adulthood. Inflammation and ulceration occurs primarily in the terminal ileum and colon, although any portion of the intestinal tract can be affected. No etiology has been identified for Crohn's disease, although a number of factors contribute to its etiopathogenesis, including genetic, microbial, inflammatory, immune, and permeability abnormalities. Conventional medications are not curative but can contribute to resolution of acute flare-ups and help maintain remission. Because significant side effects are associated with many these medications, more natural interventions to help maintain remission should be considered. Associated nutrient deficiencies, dietary interventions, and nutrient and botanical supplementation are discussed. [Abstract/Link to Full Text]

Gaby AR
Single-subject experiment evaluating nine different food sensitivity tests.
Altern Med Rev. 2004 Sep;9(3):237-8; author reply 238. [Abstract/Link to Full Text]

Herman PM, Drost LM
Evaluating the clinical relevance of food sensitivity tests: a single subject experiment.
Altern Med Rev. 2004 Jun;9(2):198-207.
A number of tests are available to identify food sensitivities. This article presents an analysis of the diagnostic value of nine different food sensitivity tests run concurrently on a healthy 33-year-old female with a previous diagnosis of environmental allergies. This case study evaluated conventional allergy tests (skin prick and serum IgE), tests of other immune-mediated reactions (serum IgG and salivary IgA), and tests that claim to measure the energetic reaction of the whole person to particular foods (kinesiology, Vega, and Carroll testing). The results of an elimination/challenge test were used as indicators of true food reactions in order to calculate the sensitivity, specificity, and positive predictive value (PPV) of each test. In a separate evaluation, the variability of results across the four tests measuring IgG was determined. Results show several tests (one of the two serum tests of IgG alone, both serum tests of IgE and IgG, skin prick testing, and Carroll testing) may have very high (100 percent) specificity and PPV when test results are compared to the results of an elimination/challenge test. Sensitivity, however, is low across tests (50-60 percent), likely because different tests measure different mechanisms of food reactions and because food sensitivities can be the result of a number of different mechanisms. Very little consistency was found among the results of the four tests measuring IgG - 79-83 percent disagreement. This study shows a number of tests may be useful in identifying foods to which a patient is reactive; however, no one test is likely to identify all reactive foods. [Abstract/Link to Full Text]

Czap A
The level playing field.
Altern Med Rev. 2004 Sep;9(3):235-6. [Abstract/Link to Full Text]

Monograph. Hypericum perforatum.
Altern Med Rev. 2004 Sep;9(3):318-25. [Abstract/Link to Full Text]

Monograph. Policosanol.
Altern Med Rev. 2004 Sep;9(3):312-7. [Abstract/Link to Full Text]

Monograph. Diosmin.
Altern Med Rev. 2004 Sep;9(3):308-11. [Abstract/Link to Full Text]

Brown AC, Hairfield M, Richards DG, McMillin DL, Mein EA, Nelson CD
Medical nutrition therapy as a potential complementary treatment for psoriasis--five case reports.
Altern Med Rev. 2004 Sep;9(3):297-307.
This research evaluated five case studies of patients with psoriasis following a dietary regimen. There is no cure for psoriasis and the multiple treatments currently available only attempt to reduce the severity of symptoms. Treatments range from topical applications, systemic therapies, and phototherapy; while some are effective, many are associated with significant adverse effects. There is a need for effective, affordable therapies with fewer side effects that address the causes of the disorder. Evaluation consisted of a study group of five patients diagnosed with chronic plaque psoriasis (two men and three women, average age 52 years; range 40-68 years) attending a 10-day, live-in program during which a physician assessed psoriasis symptoms and bowel permeability. Subjects were then instructed on continuing the therapy protocol at home for six months. The dietary protocol, based on Edgar Cayce readings, included a diet of fresh fruits and vegetables, small amounts of protein from fish and fowl, fiber supplements, olive oil, and avoidance of red meat, processed foods, and refined carbohydrates. Saffron tea and slippery elm bark water were consumed daily. The five psoriasis cases, ranging from mild to severe at the study onset, improved on all measured outcomes over a six-month period when measured by the Psoriasis Area and Severity Index (PASI) (average pre- and post-test scores were 18.2 and 8.7, respectively), the Psoriasis Severity Scale (PSS) (average pre- and post-test scores were 14.6 and 5.4, respectively), and the lactulose/mannitol test of intestinal permeability (average pre- and post-test scores were 0.066 to 0.026, respectively). These results suggest a dietary regimen based on Edgar Cayce's readings may be an effective medical nutrition therapy for the complementary treatment of psoriasis; however, further research is warranted to confirm these results. [Abstract/Link to Full Text]

Wang Y, Prentice LF, Vitetta L, Wluka AE, Cicuttini FM
The effect of nutritional supplements on osteoarthritis.
Altern Med Rev. 2004 Sep;9(3):275-96.
Osteoarthritis (OA) is the most common form of joint disease and cause of musculoskeletal disability in the elderly. Conventional management of OA primarily focuses on the relief of symptoms, using agents such as analgesics and non-steroidal anti-inflammatory drugs (NSAIDs). These drugs, however, are associated with significant side effects and fail to slow the progression of OA. Several nutritional supplements have been shown to be at least as effective as NSAIDs at relieving the symptoms of OA, and preliminary evidence suggests several of these supplements may have a role in influencing the course of OA. The purpose of this article is to review the available literature on the effectiveness and safety of nutritional supplements for the treatment of OA. [Abstract/Link to Full Text]

Helms S
Cancer prevention and therapeutics: Panax ginseng.
Altern Med Rev. 2004 Sep;9(3):259-74.
Panax ginseng has been used as a medicinal plant in China for thousands of years. Current use in Western countries has been diverse, with focused research on cancer therapeutics. P. ginseng apparently mitigates cancer through anti-inflammatory, antioxidant, and apoptotic mechanisms to influence gene expression. Additional mechanisms of investigation include influence on neurotransmission and immunosurveillance. Low toxicity and positive studies in concomitant use with other chemotherapeutic agents is promising. Although there is no conclusive evidence of P. ginseng curing cancer, research has continually found tumor inhibition, especially in the promotion and progression phases. [Abstract/Link to Full Text]

Patrick L
Selenium biochemistry and cancer: a review of the literature.
Altern Med Rev. 2004 Sep;9(3):239-58.
In recent years, the role of selenium in the prevention of a number of degenerative conditions including cancer, inflammatory diseases, thyroid function, cardiovascular disease, neurological diseases, aging, infertility, and infections, has been established by laboratory experiments, clinical trials, and epidemiological data. Most of the effects in these conditions are related to the function of selenium in antioxidant enzyme systems. Replenishing selenium in deficiency conditions appears to have immune-stimulating effects, particularly in patients undergoing chemotherapy. However, increasing the levels of selenoprotein antioxidant enzymes (glutathione peroxidase, thioredoxin reductase, etc.) appears to be only one of many ways in which selenium-based metabolites contribute to normal cellular growth and function. Animal data, epidemiological data, and intervention trials have shown a clear role for selenium compounds in both prevention of specific cancers and antitumorigenic effects in post-initiation phases of cancer. [Abstract/Link to Full Text]

Monograph. Withania somnifera.
Altern Med Rev. 2004 Jun;9(2):211-4. [Abstract/Link to Full Text]

Recent Articles in Journal of Physiology and Pharmacology

Gonz�les-Luis G, Fletcher AJ, Moreno L, P�rez-Vizca�no F, Blanco CE, Villamor E
Nitric oxide-mediated nonadrenergic noncholinergic relaxation of piglet pulmonary arteries decreases with postnatal age.
J Physiol Pharmacol. 2007 Mar;58(1):45-56.
Nonadrenergic noncholinergic (NANC) vasodilator mechanisms may contribute to the maintenance of adult pulmonary and systemic vascular tone. However, their actions in the neonatal circulation have not been studied. We aimed to investigate NANC vasorelaxation in neonatal and 2-week-old piglet pulmonary and mesenteric arteries and to examine the potential role of nitric oxide (NO) in this phenomenon. Responses to electric field stimulation (EFS, 50V, 0.25-32 Hz) were investigated in pulmonary and mesenteric artery rings (external diameter 150-200 microm) precontracted with the thromboxane A2 mimetic U46619, in the presence of guanethidine (10 microM) and atropine (10 microM). Under these conditions, EFS resulted in a frequency dependent relaxation of newborn pulmonary (maximal relaxation of 53+/-9.1%), mesenteric (68.8.2+/-7.1%) and 2-wk-old mesenteric (46 6.3%) arteries but this relaxation was significantly reduced (4.5+/-2.2%) in 2-week-old pulmonary arteries. In neonatal pulmonary arteries, the neurotoxin tetrodotoxin (0.3 muM), the NO synthase inhibitor L-NAME (0.1 mM), and the guanylyl cyclase inhibitor ODQ (10 microM) abolished EFS-induced relaxations, suggesting that NANC relaxation of porcine neonatal pulmonary arteries is mediated by NO, which is probably neuronal in origin. However, The expression in pulmonary arteries of the neuronal NO synthase (nNOS), as determined by Western-blot analysis, increased with postnatal age whereas the expression of the endothelial NOS (eNOS) did not change. In conclusion, NANC relaxation is present in neonatal pulmonary and mesenteric arteries and it is, at least partially, mediated through NO. NANC relaxation of porcine pulmonary and mesenteric arteries decreases with postnatal maturation. [Abstract/Link to Full Text]

Kristek F, Koprdov� R, Cebov� M
Long-term effects of early administered sildenafil and NO donor on the cardiovascular system of SHR.
J Physiol Pharmacol. 2007 Mar;58(1):33-43.
We evaluated the long-term effect of NO-donor, pentaerythrityl tetranitrate (Petn), and sildenafil citrate (sildenafil) on the cardiovascular system of the spontaneously hypertensive rat (SHR). Petn (100 mg/kg/day) and sildenafil (10 mg/kg/day) were administered to SHR individually or together from week 4 (pre-hypertensive period) to week 9 of age. Blood pressure (BP) was measured using a plethysmographic method. The animals were perfused with a glutaraldehyde fixative (120 mmHg). Carotid (AC) and coronary artery (RS) were processed according to electron microscopy procedure. Geometry of the arteries was measured on semi-thin sections using light microscopy. Administration of Petn and sildenafil to SHR individually or together did not prevent an increase of BP, but evoked a decrease of cardiac hypertrophy. Petn and sildenafil affected the geometry of RS and AC differently. In the RS, an increase of inner diameter (ID) without an increase of wall thickness (WT) resulted in increased WT/ID and circumferential stress. In the AC, changes in ID were accompanied by changes in WT and, thereby, WT/ID and circumferential stress remained unchanged. The arterial wall mass of both arteries was increased. The data suggest that administration of the NO donor, Petn, and/or sildenafil does not result in a beneficial effect on the myocardium or on the geometry of the carotid and coronary arteries. [Abstract/Link to Full Text]

Laudi S, Weimann J, Haschke M, Trump S, Schmitz V, Christians U, Kaisers U, Steudel W
Worsening of long-term myocardial function after successful pharmacological pretreatment with cyclosporine.
J Physiol Pharmacol. 2007 Mar;58(1):19-32.
Pretreatment with cyclosporine (CsA) decreases infarct size 24h after myocardial ischemia/reperfusion (I/R). The goal of this study was to determine effects of CsA pretreatment on long-term cardiac function after I/R-injury. Rats were randomly assigned to group-1: vehicle-only, group-2: CsA-5mg/kg/day, and group-3: CsA-12.5mg/kg/day given orally for three days prior to I/R-injury (30 min of left anterior descending coronary artery occlusion). Post-I/R survival and cardiac function were evaluated 14 days after I/R-injury by echocardiography and invasive hemodynamic measurements. Rats with I/R-injury showed increased left ventricular pressure (LVEDP) compared to rats without I/R-injury (p<0.005). Although CsA initially decreased infarct size, no differences of LVEDP were seen 14 days after I/R-injury (vehicle: 21.2+/-8.9 mmHg, CsA-5mg/kg/day: 21.5+/-0.7 mmHg, CsA-12.5mg/kg/day: 20.5+/-9.4 mmHg). Ejection fraction and fractional shortening were decreased compared to baseline, but showed no differences between groups. On day 14, a dose-dependent increase in left ventricular end diastolic diameter was seen (p<0.001). CsA pretreatment was associated with a dose-dependent decrease in post-I/R-survival (vehicle: 56%, CsA-5mg/kg/day: 32%, CsA-12.5mg/kg/day: 16%; p=0.017). CsA pretreatment did not improve long-term cardiac function despite decreased infarct size 24h after I/R-injury, but increased post-I/R mortality significantly. Poor cardiac function after CsA pretreatment might be caused by left ventricular dilation. [Abstract/Link to Full Text]

Pires W, Wanner SP, La Guardia RB, Rodrigues LO, Silveira SA, Coimbra CC, Marubayashi U, Lima NR
Intracerebroventricular physostigmine enhances blood pressure and heat loss in running rats.
J Physiol Pharmacol. 2007 Mar;58(1):3-17.
The aim of this study was to evaluate the effects of the stimulation of central cholinergic synapses in the regulation of heat loss in untrained rats during exercise. The animals were separated into two groups (exercise or rest) and tail skin temperature (T(tail)), core temperature and blood pressure were measured after injection of 2 microL of 5x10(-3) M physostigmine (Phy; n = 8) or 0.15 M NaCl solution (Sal; n = 8) into the lateral cerebral ventricle. Blood pressure was recorded by a catheter implanted into the abdominal aorta, T(tail) was measured using a thermistor taped to the tail and intraperitoneal temperature (T(b)) was recorded by telemetry. During exercise, Phy-treated rats had a higher increase in mean blood pressure (147 +/- 4 mmHg Phy vs. 121 +/- 3 mmHg Sal; P < 0.001) and higher T(tail) (26.4 +/- 1.0 degrees C Phy vs. 23.8 +/- 0.5 degrees C Sal; P < 0.05) that was closely related to the increase in systolic arterial pressure (r = 0.83; P < 0.001). In addition, Phy injection attenuated the exercise-induced increase in T(b) compared with controls without affecting running time. We conclude that the activation of central cholinergic synapses during exercise increases heat dissipation due to the higher increase in blood pressure. [Abstract/Link to Full Text]

Baenkler HW
Functional-eicosanoid-test (FET) and disease.
J Physiol Pharmacol. 2006 Dec;57 Suppl 1265-72.
Eicosanoids are involved in most cellular activities. Measurement of their levels in tissue or blood renders information about the function of activated cells. An extended analysis will improve the conclusions regarding eicosanoid-related diseases. Peripheral white blood cells (WBC) were used for the test. Stimulating or inhibiting substances to influence the generation and the metabolism of eicosanoids were separately added to the samples. Prostaglandins (PG) and leukotrienes (LT) were measured after incubation in culture medium for 20 minutes at room temperature. Healthy controls rendered normal data. Patients with intolerance to acetylsalicylic acid (ASS) showed an elevated output of PG and LT upon stimulation. Addition of ASS shifted from PG to LT. An altered pattern of eicosanoids also was found in patients suffering from gastroduodenal ulcer and in intestinal malignancy. The sensitivity regarding the ASS-intolerance is >80% and the specificity in the same group >70%. We concluded that the FET is a suitable test for the demonstration and verification of intolerance to ASS. It also detects an imbalance of the eicosanoids in intestinal malignancy. This makes the FET a helpful tool for diagnosis and for the elucidation of pathogenic mechanisms. [Abstract/Link to Full Text]

Sch�fer D
Testing and typing of eicosanoid-patterns.
J Physiol Pharmacol. 2006 Dec;57 Suppl 1247-64.
Eicosanoids are pleiotrope mediators with essential function in most biological processes. The network of inter- and intracellular signalling requires coordinated cellular information processing. The cross-talk is characterised by complex non-linear responses to combinations of different stimuli and cells, but little is known about the density of these interactions. Here I have analysed eicosanoid interactions carried out by functional eicosanoid testing and typing (FET) in leucocytes from healthy subjects and patients suffering from inflammatory diseases. The known eicosanoid pattern scoring was extended to metabolically linked prostaglandin E(2) and peptido-leukotrienes pathways, both alone and in all pair wise combinations, for basal, maximal synthesis capacity, acetylsalicylic acid, and neuropeptide modification. Eicosanoids fluctuated over twenty minutes context-dependent dynamically, demanding further data integration. The integration suggested that many stimuli converge for quantitative discrimination applying a total eicosanoid pattern score (TEP). Varying cellular activities affect FET and thereby TEP. The non-additive metabolic interactions were consistent with known mechanisms of metabolic pathway cross-talk. FET-based modelling of eicosanoid circuits most suitably reflects the fundamental impact of eicosanoids in maintaining cellular integrity of organ and body function. This might improve our present understanding of complex cellular eicosanoid interactions of inflammatory diseases and might be applied for diagnostic considerations. [Abstract/Link to Full Text]

Velten FW, Bayerl C, Baenkler HW, Schaefer D
Functional eicosanoid test and typing (FET) in acetylsalicylic acid intolerant patients with urticaria.
J Physiol Pharmacol. 2006 Dec;57 Suppl 1235-46.
One of the common side effects of acetylsalicylic acid (ASA) is the induction of pseudoallergic reactions that range from urticarial wheals to anaphylactic shock. At present there is no reliable detection method available for the diagnosis of ASA-hypersensitivity and its relation to clinical symptoms. The purpose of the present study was to evaluate the functional eicosanoid typing (FET) score taking into account several parameters of the equilibrium between prostaglandins (PG) and peptido-leukotriens (pLT). A total eicosanoid pattern score (TEP) ranging from 0.0 to 3.0, was defined that exhibited significant differences (p <or= 0.001) between ASA-intolerant patients and healthy subjects. In addition to the differentiation of both groups at a TEP cut-off value of 1.0, the increasing TEP values correlated with an increasing severity of clinical symptoms in ASA-intolerant patients. We conclude that the FET has the potential for the safe and reliable detection of ASA-intolerance and, probably, other eicosanoid-related pseudoallergic reactions. [Abstract/Link to Full Text]

Baenkler M, Leykauf M, John S
Functional analysis of eicosanoids from white blood cells in sepsis and SIRS.
J Physiol Pharmacol. 2006 Dec;57 Suppl 1225-33.
Sepsis and SIRS are affections with major alterations in inflammatory activity. The impact of prostaglandins (PG) and leukotrienes (LT) produced from white blood cells (WBC) in this context is not completely understood. Thirty nine patients with sepsis or SIRS were investigated in comparison to 10 healthy controls. WBC were collected and separately exposed to arachidonic acid (AA) or to nothing else. After centrifugation, the generated PGE(2) and LTCDE(4) with or without stimulation were measured in the supernatant. LT-levels were significantly higher during sepsis/SIRS than in controls whereas PG-levels of patients were decreased to those of controls in basic condition. The relation between the level with and without stimulation showed a significant higher ratio in PG in contrast to LTs. The survivor's ratio in LT levels was significantly higher than that of non-survivors, which did not differ from controls. Generation of LT from WBC is enhanced during sepsis/SIRS, but LT generation after stimulation only in survivors but not in non-survivors. This inability of WBC to generate LT during sepsis in non-survivors could be predictive regarding the outcome of sepsis/SIRS and may be part of the "immunoparalysis" seen during sepsis in association with bad outcome. [Abstract/Link to Full Text]

Konturek PC, Kania J, Burnat G, Hahn EG
NO-releasing aspirin exerts stronger growth inhibitory effect on Barrett's adenocarcinoma cells than traditional aspirin.
J Physiol Pharmacol. 2006 Dec;57 Suppl 1215-24.
Expression of cyclooxygenase-2 (COX-2) is involved in the chronic inflammation-related development of Barrett's adenocarcinoma and the use of selective COX-2 inhibitors (coxibs) might provide new chemoprevention strategy for Barrett's adenocarcinoma (BA). Despite an excellent gastrointestinal (GI) safety profile of coxibs, their use is limited because of the possible cardiovascular complications. The coupling of NSAIDs with a NO-donating moiety has led to the birth of a new class of anti-inflammatory drugs, called the COX-inhibiting nitric oxide donators (CINODs). The member of this group, NO-aspirin (NO-ASA) retains the anti-inflammatory properties of traditional aspirin (ASA), but the release of NO accounts for anti-thromboembolic effect and better GI safety profile. The role of NO-ASA in the prevention of Barrett's adenocarcinoma (BA) has not been studied so far. Therefore, the aim of the present study was: 1) to analyse the expression of COX-2 in the biopsies obtained from BE; 2) to compare the effect of NO-ASA with that of ASA on proliferation rate in Barrett''s adenocarcinoma cell line (OE-33 cells); 3) to determine the effect of both compounds on the apoptosis rate using FACS analysis and expression of 32-kDa procaspase-3 and active proapoptotic 20-kDa caspase-3 in OE-33 cell line. The expression of COX-2 was assessed in biopsies obtained from the Barrett's mucosa and normal squamous epithelial esophageal mucosa from 20 BE patients by RT-PCR and Western blot analysis, respectively. The BA cell line (OE-33) was incubated with NO-ASA or ASA (10-1000 microM). The cell proliferation and apoptosis rate was measured by BrdU and FACS-analysis, respectively. The expression of caspase-3 (active and inactive form) was analyzed by Western blot. In Barrett's mucosa a significant up-regulation of COX-2 was observed. Compared with traditional ASA, NO-ASA caused a significantly stronger induction of apoptosis (dose-dependently). Inhibition of cell proliferation in OE-33 cells observed under NO-ASA treatment was due to the apoptosis induction. The increase in apoptotic rate was accompanied by the upregulation of active 20-kDa caspase-3. At the highest concentration (1000 microM), a necrotic death of OE-33 cells was observed under NO-ASA treatment. We conclude that: NO-ASA caused induction of apoptosis in BA cell line and slight growth inhibition. These results indicate that this compound may represent a promising chemopreventive agent for Barrett's adenocarcinoma. [Abstract/Link to Full Text]

Pfaar O, Klimek L
Eicosanoids, aspirin-intolerance and the upper airways--current standards and recent improvements of the desensitization therapy.
J Physiol Pharmacol. 2006 Dec;57 Suppl 125-13.
In 1922, Widal et al. were the first to describe intolerance reactions to acetylsalicylic acid (ASA, e.g. in aspirin) and to other nonsteroidal anti-inflammatory drugs (NSAIDs). The full clinical picture reveals a classic triad of symptoms (Samters Triad): aspirin induced bronchial asthma (with severe acute asthma attacks), aspirin-sensitivity and chronic rhinosinusitis with nasal polyps. In many cases, nasal polyps reveal as the first symptom of ASA sensitivity indicating that the upper airways are predominantly involved in the pathogenetic process. Therefore, emphasis of this article mainly focuses on the upper airways in ASA-intolerant patients. In the last decade, clear evidence has been pointed out that ASA-intolerance is related to the abnormal metabolism of arachidonic acid leading towards excessive leukotriene (LTs) production. The resulting dysbalance of the eicosanoids leukotrien and prostaglandin might be the crucial pathophysiologic keypoint of the disease. The incidence of aspirin hypersensitivity in the general population ranges from 0.6 % to 2.5% and in adult asthmatics from 4,3 % to 11%. Besides the patients history, challenge tests with Lysin-aspirin are performed as the diagnostic tool of choice. Apart from surgical or pharmacological therapy, ASA desensitization therapy is the only specific treatment of choice. As first described by Stevensson et al. in the early 1984, oral administration by means of an initial desensitization with gradually ascending doses of aspirin is followed by a daily maintenance-dose. In the last years, many publications on various desensitization protocols and routes of administration have been worked out. Recently, the intravenous route for the inititial increment desensitization has been described which might offer new therapeutical possibilities in the treatment of ASA-intolerant patients. [Abstract/Link to Full Text]

Kuczeriszka M, Badzy?ska B, Kompanowska-Jezierska E
Cytochrome P-450 monooxygenases in control of renal haemodynamics and arterial pressure in anaesthetized rats.
J Physiol Pharmacol. 2006 Nov;57 Suppl 11179-85.
The renal regulatory role of cytochrome P450 dependent metabolites of arachidonic acid (AA), vasodilator epoxyeicosatrienoic acids (EETs) and vasoconstrictor 20-hydroxyeicosatetraenoic acid (20-HETE), was examined in anaesthetised rats. We measured renal artery flow (RBF), cortical (CBF) and medullary (MBF) perfusion (laser-Doppler) and medullary tissue nitric oxide (NO, selective electrode), after non-selective inhibition of CYP-450 pathway with 1-aminobenzotriazole (ABT, 10 mg/kg i.v.) or after selective inhibition of 20-HETE synthesis with HET0016 (Taisho Co, Yoshino-cho, Japan), infused into renal artery at 0.3 mg/kg/h or into renal medulla at rates increasing from 0.15 to 1.5 mg/kg/h. ABT caused significant (by 13.7%) decrease in RBF without changing MBF. Renal arterial HET0016 increased MBF (not RBF or CBF) from 152+/-12 to 174+/-12 perfusion units (+16%, P<0.001), while medullary tissue nitric oxide was significantly increased (P<0.001). After renal medullary HET0016, renal perfusion indices were significantly higher than after HET0016 solvent (beta-cyclodextrin). Total renal blood flow seems to be under vasodilator control of EETs whereas renal medullary perfusion under tonic suppression by 20-HETE. The data document, for the first in the whole kidney studies, the functional antagonism of 20-HETE and NO. [Abstract/Link to Full Text]

Sadowski J, Badzy?ska B
Specific features and roles of renal circulation: angiotensin II revisited.
J Physiol Pharmacol. 2006 Nov;57 Suppl 11169-78.
The status of intrarenal circulation determines in part renal excretion, affects body fluid homeostasis and has a role in long term control of arterial blood pressure. The vascular resistance in the renal cortex and medulla is determined by interaction of a vast array of vasoactive hormones and paracrine factors; among these the role of constrictor angiotensin II and dilator prostaglandins and nitric oxide may appear to be dominating. The focus of this review and underlying studies is on the mechanisms whereby the microcirculation of the renal medulla is protected against the vasoconstrictor action of angiotensin II. In anaesthetized normal rats the three mentioned active agents or their inhibitors were applied and total renal blood flow and cortical, outer- and inner medullary laser-Doppler fluxes were determined; in some studies renal tissue nitric oxide was measured using selective electrodes. We conclude that angiotensin II, acting via AT1 receptors, constricts the renal cortical vasculature; in the medulla its action is effectively buffered by prostaglandin E2 but most probably not by nitric oxide. [Abstract/Link to Full Text]

Pascale CL, Szmydynger-Chodobska J, Sarri JE, Chodobski A
Traumatic brain injury results in a concomitant increase in neocortical expression of vasopressin and its V1a receptor.
J Physiol Pharmacol. 2006 Nov;57 Suppl 11161-7.
Arginine vasopressin (AVP) has been shown to promote the disruption of the blood-brain barrier (BBB) and the formation of edema in various animal models of brain injury. However, the source(s) of this AVP have not been identified. Since the cerebral cortex was considerably affected in some of these brain injury models, we sought to determine if AVP was produced in the cerebral cortex, and, if so, whether or not this cortical AVP expression was up regulated after injury. In the present study, a controlled cortical impact model of traumatic brain injury (TBI) in rats was used, and the temporal changes in expression of AVP and its V(1a) receptor were analyzed by real-time reverse-transcriptase polymerase chain reaction. The expression of AVP and its V(1a) receptor in the ipsilateral cortex adjacent to the lesion area was significantly up regulated between 4 h and 1 day post-TBI. The maximum increase in mRNA for AVP (4.3-fold) and its receptor (2.6-fold) in the ipsilateral vs. contralateral cortex was observed at 6 h post-TBI. Compared to sham-injured rats, no statistically significant changes in expression of AVP or its receptor were found in the contralateral cortex. These results suggest that the cerebral cortex is an important source of AVP in the injured brain, and the parallel increase in the expression of AVP and its cognate receptor may act to augment the actions of AVP related to promoting the disruption of the BBB and the formation of post-traumatic edema. [Abstract/Link to Full Text]

Ko?niewska E, Michalik R, Rafa?owska J, Gadamski R, Walski M, Frontczak-Baniewicz M, Piotrowski P, Czernicki Z
Mechanisms of vascular dysfunction after subarachnoid hemorrhage.
J Physiol Pharmacol. 2006 Nov;57 Suppl 11145-60.
The main consequence of subarachnoid hemorrhage, for those who survive bleeding, is delayed, persistent vasospasm of intracranial conduit arteries which occurs between the third and seventh day after the insult and results in symptomatic brain ischemia in about 40% of cases. This vasospasm is considered to be a major cause of disability of post-SAH patients. Despite extensive experimental and clinical research, mechanisms of vasospasm are not fully understood. Dysfunction of the endothelium resulting in enhanced production of vasoconstrictors, phenotypic changes of the receptors in endothelium and smooth muscle cells, increased sensitivity of vascular smooth muscle cells to vasoconstrictors, release of spasmogens from lysed blood clot and inflammatory response of the vascular wall have been demonstrated and discussed as pathological mechanisms participating in the development of spasm. In recent years more attention is paid to the functional and structural changes in microcirculation and a concept of microvascular spasm is evolving. Our experimental studies in rat model of SAH strongly suggest that microcirculatory dysfunction and delayed vasospasm are related to the severity of acute, transient ischemia caused by critical decrease of perfusion pressure and active vasoconstriction immediately after the bleeding. [Abstract/Link to Full Text]

McCarron RM, Chen Y, Tomori T, Strasser A, Mechoulam R, Shohami E, Spatz M
Endothelial-mediated regulation of cerebral microcirculation.
J Physiol Pharmacol. 2006 Nov;57 Suppl 11133-44.
Vascular endothelial cells are important not only for maintaining homeostasis, but also in pathogenesis of vascular disorders. Cerebral capillary and microvascular endothelial cells play an active role in maintaining cerebral blood flow, microvascular tone and blood brain barrier functions. Factors produced and released by endothelial cells, other brain cells and circulating blood cells participate in these regulatory functions. In particular, endothelin-1 (ET-1) and nitric oxide (NO) are known to contribute to the functional vascular changes under pathological conditions (e.g., hypertension, arteriosclerosis, and stroke). This report describes the involvement of endothelial cell mediators in the post-ischemic hypoperfusion induced by brain ischemia and in vitro endothelial responses (Ca(2+) mobilization and cytoskeletal rearrangements) to ET-1 and its interactions with NO or 2-AG. The capacity of NO and endocannabinoids to counteract ET-1-induced cerebral capillary and microvascular endothelial responses indicates that they may actively participate in EC function and implicates them in physiological and pathophysiological conditions. [Abstract/Link to Full Text]

Glac W, Borman A, Badtke P, Stojek W, Orlikowska A, Tokarski J
Amphetamine enhances Natural Killer cytotoxic activity via beta-adrenergic mechanism.
J Physiol Pharmacol. 2006 Nov;57 Suppl 11125-32.
Although addiction to amphetamine (AMPH) is a serious social and medical problem, the data concerning AMPH - immune interactions are still not numerous. To analyze the mechanism of AMPH-induced changes in the function of the immune system, rats were pretreated with beta-adrenergic receptor antagonist propranolol (PROP; 5 mg/kg, i.p.) prior to AMPH (1 mg/kg, i.p.) administration. Natural Killer cells cytotoxicity (NKCC) ((51)Cr-release assay), the number of LGLs (NK cells) (Timonen method), leukocytes, lymphocytes and monocytes, and plasma corticosterone level (CORT) (RIA) were evaluated in the peripheral blood and spleen. In the peripheral blood increases in NKCC (+331 Delta %), as well as in LGL (+33 Delta %) and monocyte (+65 Delta %) number observed after AMPH were partially inhibited by PROP (respectively by 30%, 19%, and 30%) in contrast to lymphopenia (-19 Delta %) and granulocytosis (+65 Delta %) which were not affected by beta-blockade. In the spleen AMPH-induced decreases in NKCC (-25 Delta %) and in all the leukocyte populations number (approximately -30 Delta %) were completely blocked by PROP. Plasma CORT level, highly elevated by AMPH (+337 Delta %), was attenuated nearly by 50% under beta-adrenergic blockade. These data indicate that AMPH-induced enhancement of cytotoxic activity of NK cell is related to beta-adrenergic mechanism. [Abstract/Link to Full Text]

Jochem J, Zwirska-Korczala K, Zabielski R, Kato I, Kuwahara A
Cardiovascular effects of centrally acting orexin A in haemorrhage-shocked rats.
J Physiol Pharmacol. 2006 Nov;57 Suppl 11115-24.
Orexin A influences the central cardiovascular regulation, since after intracerebroventricular (icv) administration it evokes short-lasting increases in mean arterial pressure (MAP) and heart rate (HR) in normotensive animals. The aim of the present study was to examine haemodynamic effects of orexin A in haemorrhage-shocked rats. Experiments were carried out in anaesthetized Wistar rats subjected for a critical irreversible haemorrhagic hypotension of 20-25 mmHg, which resulted in the death of all saline icv-treated control animals within 30 min. Orexin A (0.5-1.5 nmol; icv) administered at 5 min of critical hypotension evoked dose-dependent long-lasting increases in MAP, HR and renal, mesenteric and hindquarters blood flows, with a 100% survival of 2 h after treatment (1.5 nmol; icv). Changes in MAP and peripheral haemodynamics were inhibited by intravenous pretreatment with alpha(1)- and alpha(2)-adrenoceptor antagonists prazosin (0.5 mg/kg) and yohimbine (1.0 mg/kg), respectively. Moreover, both antagonists significantly decreased the survival rate to 16.6 and 33.3% (P<0.05 vs. orexin A [1.5 nmol]-treated group). In contrast, beta-adrenoceptor antagonist propranolol (1.0 mg/kg) completely blocked orexin A-induced HR changes, without influence on MAP, peripheral blood flows and the survival rate. Therefore, we conclude that centrally acting orexin A evokes the resuscitating effect in haemorrhage-shocked rats due to the activation of the sympathetic nervous system. [Abstract/Link to Full Text]

Puchalska L, Belkania GS
Haemodynamic responses to the dynamic exercise in subjects exposed to different gravitational conditions.
J Physiol Pharmacol. 2006 Nov;57 Suppl 11103-13.
Different types of adaptation of the cardiovascular system to the gravitational forces (hypokinetic and hyperkinetic) have been described in the healthy and the sick subjects under resting conditions. The aim of the present study was to elucidate whether haemodynamic responses to the dynamic exercise performed under various gravitational conditions are determined by the type of adaptation of the cardiovascular system to the gravitational forces at rest. The study was performed on 249 healthy men, 20-60 years old. To assess the type of regulation of the cardiovascular system arterial blood pressure (MABP), heart rate (HR), stroke volume (SV), cardiac output (CO), and systolic function (SF) of the heart were determined in each subject at rest in the upright (orthostatic state) and in the supine position. Subsequently, the subjects were performing exercise on a cycloergometer in the sitting and the supine position. Four gradually increasing workloads were applied. Measurements of HR, MABP, SV, CO, and SF were repeated at the end of each workload. SV, CO and SF were determined by means of rheography. The results revealed that in the individuals showing at rest the hypokinetic type of orthostatic cardiovascular adaptation the augmentation of CO during exercise in the sitting position was caused by significant increases of HR and SV. In contrast, the subjects with the hyperkinetic type of orthostatic adaptation the increase in CO during exercise in the sitting position was much smaller and resulted predominantly from acceleration of HR. It is concluded that the cardiovascular adaptation to the dynamic exercise depends not only on the position of the body in which the exercise is performed but it is also determined by the type of adaptation of the cardiovascular system to the gravitational forces at rest. In the sitting position the pumping capacity of the heart is significantly greater in the hypokinetic than in the hyperkinetic type of the cardiovascular regulation; this relationship being reversed during exercise in the horizontal position. [Abstract/Link to Full Text]

Izdebska E, Izdebski J, Cybulska I, Makowiecka-Ciesla M, Trzebski A
Moderate exercise training reduces arterial chemoreceptor reflex drive in mild hypertension.
J Physiol Pharmacol. 2006 Nov;57 Suppl 1193-102.
The aim of our study was to check the responsiveness the chemoreceptor reflex in 28 young mildly hypertensive men (HTS), aged 18-32 years and 25 normotensive male subjects (NTS) aged 19-32 years, before and after 3-months dynamic exercise training. We tested the hypothesis that dynamic training reduces arterial chemoreceptor drive in mild hypertension. Circulatory response to 3-min hyperoxic inactivation of arterial chemoreceptors induced by 70% oxygen breathing was measured before and after training. Arterial blood pressure (BP) was recorded continuously by Finapres method, stroke volume and arm blood flow were registered by impedance reography, heart rate by ECG. Both groups were submitted to moderate 3-months dynamic exercise training. Before training the hyperoxic breathing caused in HTS a significant decrease in systolic BP by 6+/-1 mmHg p<0.01, in diastolic BP by 2+/-0.6 mmHg p<0.01, and in total peripheral vascular resistance (TPR) by 0.24+/-0.04 TPRU (p<0.01). After training hyperoxia augmented systolic BP by 2.64+/-1.9 mmHg (NS), diastolic BP by 2+/-1 mmHg p<0.05, and TPR by 0.043+/-0.05 TPRU (ANOVA). In NTS before training brief hyperoxia produced insignificant change in BP and TPR. In NTS after training hyperoxia increased systolic BP by 4.2 mm Hg+/-1.23 p<0.01 and diastolic BP by 3.1+/-0.6 mmHg p<0.01 respectively and TPR by 0.053+/-0.02 TPRU. Our results confirm earlier finding on the enhanced arterial chemoreceptor reflex drive in mild human hypertension. We conclude that normalizing arterial blood pressure in subjects with mild hypertension which occurred after 3-months dynamical exercise training is due to attenuation of the sympathoexcitatory chemoreceptor reflex drive by exercise training. The mechanism of this effect requires further study. [Abstract/Link to Full Text]

Sinski M, Lewandowski J, Abramczyk P, Narkiewicz K, Gaciong Z
Why study sympathetic nervous system?
J Physiol Pharmacol. 2006 Nov;57 Suppl 1179-92.
Cardiovascular diseases are the most frequent causes of morbidity and mortality around the world. However, during last decades, an improvement was made in diagnosis and therapy of cardiovascular diseases, there was still a need for better understanding of their pathophysiology. Among neurohormonal systems, SNS plays a central role in cardiovascular regulation in both health and disease. Involvement of SNS in pathogenesis of hypertension, coronary artery disease or heart failure is well known and proved. Methods such as microneurography, direct catecholamine measurements, heart rate variability or baroreflex sensitivity assessment allowed studying sympathetic activity and its influence on cardiovascular disorders. Although introduced into scientific practice methods of SNS evaluation are not commonly used in the clinic. However, two of the methods: analysis of heart rate variability (HRV) and baroreflex sensitivity (BRS) were recommended as the diagnostic tools and can be found in clinical guidelines as basic assessment methods. [Abstract/Link to Full Text]

Kozluk E
Pathophysiological mechanism of cardiac arrhythmias as a key for optimal nonpharmacological treatment.
J Physiol Pharmacol. 2006 Nov;57 Suppl 1169-77.
Pathological automatism and triggered activity had focal origin. Thus, the treatment has to be aimed at ablation of the arrhythmogenic region. Some arrhythmogenic places can be precisely characterized by analysis of ECG patterns. Among them are foci located close to the pulmonary veins, sinus node, ventricular outflow tracts or mitroaortic commissura. Classical ablation of these loci is highly successful. In other types of focal arrhythmias electro anatomical systems make possible to create 3D map, with activation sequence allowing for identification of the place where the arrhythmia could be eliminated. In reentrant mechanism of the arrhythmia the impulse circulates around the loop via the cardiac muscle. In case of the atrioventricular nodal reentrant tachycardia, atrial flutter or bundle branch ventricular tachycardia the loop can be easily outlined. Ablation can be performed using the anatomical method without induction of the tachycardia. In patients with the ventricular tachycardia with multiple forms or hemodynamically unstable it is possible to perform electro anatomical map with visualization of the scar and the border zones. In this case the proarrhythmic region in the borderline zone is the aim of linear ablation without induction of tachycardias. In the chaotic tachycardias (atrial or ventricular fibrillation), the arrhythmogenic substrate is too much dispersed to destroy them. Therefore, the ablation is aimed at the trigger which is initiating the arrhythmia (for instance the pathological Purkinje fibers). The excitability of the substrate may be also modified by pacemakers (ventricular or atrial resynchronization). In the life-threatening arrhythmias implantable cardioverter-defibrillator is necessary. [Abstract/Link to Full Text]

Smietanowski M, Szelenberger W, Trzebski A
Nonlinear dynamics of the cardiovascular parameters in sleep and sleep apnea. In memory of Alberto Malliani (1935-2006)--a brave heart and beautiful mind.
J Physiol Pharmacol. 2006 Nov;57 Suppl 1155-68.
The aim of our study was to characterize the dynamics of heart rate variability (HRV) during sleep in healthy subjects and in patients with obstructive sleep apnea syndrome (OSAS). Present results were compared with earlier data obtained in healthy subjects (1) performing intermittent voluntary apneas. Power spectra in low (LF) and high (HF) frequency band and non linear indices: correlation dimension (CD) and recurrence plots were computed. New indices were applied: a beat-to beat control (BBC) for the assessment of cardiovascular regulatory mechanisms as cardiac, vascular or mixed type control and COT for quantification of relative contribution of cardiac and vascular component in blood pressure variability. During Wake stage in OSAS patients mean LF component was augmented (0.035 s(2)/Hz) comparing to healthy subjects (0.012 s(2)/Hz). Nonlinear indices suggest reduced HRV dynamics complexity in OSAS patients. Similar pattern could be observed when comparing LF component, CD and recurrence parameters during spontaneous breathing and in consecutive voluntary apneas. The results correlate with 20% increase in BBC vascular control type and COT inversion form +0.08 to - 0.12. Changes in BBC and COT along with power spectra and nonlinear dynamics indices appear to signal risk and/or initiation of arterial hypertension in OSAS patients. [Abstract/Link to Full Text]

Szczepa?ska-Sadowska E
Neuropeptides in neurogenic disorders of the cardiovascular control.
J Physiol Pharmacol. 2006 Nov;57 Suppl 1131-53.
Growing number of studies reveal that the brain neural network plays significant role in the short-term and long-term regulation of the cardiovascular functions. The neurons involved in the complex neurogenic control of the cardiovascular system use classical neurotransmitters and nonconventional mediators such as peptides (angiotensin II, vasopressin, natriuretic peptides, endothelins, opioids, cytokines), steroids, ouabain-like factors and gaseous compounds. Among them the neuropeptides form a group of substances arising significant interest. Thanks to wide distribution of peptidergic neurons in the central nervous system, location of peptide receptors on neurons and glial cells, versatile but frequently overlapping mechanisms of activation of the intracellular processes the neuropeptides play significant role in short-term and long-term regulation of excitability and remodeling of the neurons. In several instances they modulate effects of the classical transmitting systems involved in regulation blood pressure, heart rate, water-electrolyte balance, metabolism, stress, pain, mood and memory. Prolonged activation or inhibition of specific neuropeptide pathways frequently results in long-lasting disorders of several regulatory systems. In this review this is exemplified by overactivity of angiotensin II, vasopressin and cytokines in the brain during hypertension, heart failure and stress. Multifarious actions of angiotensin II and vasopressin, and their mutual interaction with cytokines make of these neuropeptides excellent candidates for the compounds responsible for long-term resetting of the central cardiovascular control, and forming a link between the cardiovascular diseases, stress and mood disorders. [Abstract/Link to Full Text]

Johnson AK, Grippo AJ
Sadness and broken hearts: neurohumoral mechanisms and co-morbidity of ischemic heart disease and psychological depression.
J Physiol Pharmacol. 2006 Nov;57 Suppl 115-29.
Heart disease and depression are highly co-morbid. Clinical and experimental research over the past 70 years has led to several neurohumoral hypotheses of causative factors present under the conditions of either heart failure or of psychological depression. Some of these hypothesized factors are common to both disorders and are therefore attractive candidates to account for the high incidence of co-occurrence of depression and heart disease. One experimental approach to study the co-morbidity of heart failure and depression has been to study the behavioral, biochemical and physiological changes in a chronic mild stress model of depression and in heart failure induced by experimental myocardial infarction. Our studies have led us to focus on the pro-inflammatory cytokines, in particular tumor necrosis factor (TNF)-alpha, and the renin-angiotensin-aldosterone system. Both of these families of humoral factors are elevated in human heart failure and in depression and the two experimental models we have studied. The demonstrated validity of each of these models will be of great value in elucidating the nature of the actions and interactions of these humoral agents as they contribute to the co-morbid conditions of heart failure and depression. [Abstract/Link to Full Text]

Wierzba TH, Olek RA, Fedeli D, Falcioni G
Lymphocyte DNA damage in rats challenged with a single bout of strenuous exercise.
J Physiol Pharmacol. 2006 Nov;57 Suppl 10115-31.
Exercise induces extensive generation of reactive oxygen species, which are responsible for tissue damage: enzymes inactivation, lipid peroxidation and single strand breaks in DNA. Defense system against free radicals is consisting of enzymes such as superoxide dismutase, catalase, glutathione peroxidase, and numerous non-enzymatic antioxidants. The study was performed to evaluate the effect of a single bout of submaximal running exercise, on the lymphocyte DNA strand breaks and also to test how supplementation with tempol - a membrane-permeable SOD-mimetic (0.2 mmol/kg/day) influences the eventually evoked damage. Male, Wistar rats were challenged with graded 50 min. running on treadmill at intensity up to 75-85% of predicted VO(2)max. The DNA strand breaks in individual lymphocytes were determined by using a gel electrophoretic technique - "comet" assay. We found substantial lymphocyte DNA damage 60 min. after the exercise. Tempol failed to prevent from oxidative damage in rats challenged with exercise. Moreover tempol by itself induced higher DNA damage than the exercise bout. [Abstract/Link to Full Text]

Zendzian-Piotrowska M, Baranowski M, Zabielski P, G�rski J
Effects of pioglitazone and high-fat diet on ceramide metabolism in rat skeletal muscles.
J Physiol Pharmacol. 2006 Nov;57 Suppl 10101-14.
Ceramide is involved in the pathogenesis of insulin resistance in skeletal muscles of humans and rodents. However, there are conflicting reports in the literature on the effect of thiazolidinediones (a new class of insulin sensitizing drugs) on skeletal muscle ceramide content. Therefore, the aim of our study was to examine the effect of pioglitazone on the level of ceramide and its metabolites and on the activity of the key enzymes of ceramide metabolism in different skeletal muscle types of the rat. The experiments were carried out on rats fed either a standard chow or a high-fat diet for 21 days. Each group was divided into two subgroups: control and treated with pioglitazone for 14 days. High-fat diet increased the content of ceramide in the soleus and in the red section of the gastrocnemius, but not in the white section of the latter. The activity of neutral Mg(2+)-dependent sphingomyelinase and acid sphingomyelinase was simultaneously reduced in all examined muscles. Administration of pioglitazone decreased ceramide level in the soleus and in the red section of the gastrocnemius in rats fed either diet. This effect could not be attributed to decreased rate of ceramide formation from sphingomyelin or to its augmented deacylation to sphingosine. Pioglitazone treatment reduced the concentration of plasma free fatty acids in rats fed on either diet. Therefore, we conclude that the drug decreased the muscle content of ceramide by reducing its de novo synthesis. The results of our study indicate that reduction in ceramide level may be one of the mechanisms by which pioglitazone improves skeletal muscle insulin sensitivity. [Abstract/Link to Full Text]

Gasiorowska A, Mikulski T, Smorawi?ski J, Kaciuba-U?ci?ko H, Cybulski G, Ziemba AW, Krzemi?ski K, Niewiadomski W, Nazar K
Cardiovascular and neurohormonal responses to lower body negative pressure (LBNP): effect of training and 3 day bed rest.
J Physiol Pharmacol. 2006 Nov;57 Suppl 1085-100.
Both intensive training and bed confinement impair orthostatic tolerance, however, moderate training may exert beneficial effect on cardiovascular adjustment to gravitational stimuli. It was hypothesized that moderate training attenuates effects of bed rest. To test this assumption 24 healthy male volunteers aged 20.8+/-0.9 yrs were subjected to 6 degrees head down bed rest (HDBR) for 3 days before and after 6 weeks of moderate endurance training. Before and after HDBR graded LBNP tests (-15, -30, -50 mmHg) were performed. During these tests heart rate (HR), stroke volume (SV), blood pressure (BP), plasma catecholamines, ACTH, adrenomedullin, atrial natriuretic peptide, plasma renin activity (PRA) and hematocrit were determined. HDBR did not systematically influence LBNP tolerance up to -50 mmHg, but it enhanced rates of reduction of SV, cardiac output and systolic BP and increased elevations of HR and PRA. Training did not alter significantly effects of HDBR on LBNP-induced changes in HR, SV, CO and TPR but it attenuated decrease in systolic BP and diminished increases in plasma noradrenaline and PRA. In conclusion, training has negligible effect on the HDBR-induced changes in central hemodynamics during LBNP but may increase vascular sensitivity to some vasoconstricting factors. [Abstract/Link to Full Text]

Zoladz JA, Korzeniewski B, Grassi B
Training-induced acceleration of oxygen uptake kinetics in skeletal muscle: the underlying mechanisms.
J Physiol Pharmacol. 2006 Nov;57 Suppl 1067-84.
It is well known that the oxygen uptake kinetics during rest-to-work transition (V(O2) on-kinetics) in trained subjects is significantly faster than in untrained individuals. It was recently postulated that the main system variable that determines the transition time (t(1/2)) of the V(O2) on-kinetics in skeletal muscle, at a given moderate ATP usage/work intensity, and under the assumption that creatine kinase reaction works near thermodynamic equilibrium, is the absolute (in mM) decrease in [PCr] during rest-to-work transition. Therefore we postulate that the training-induced acceleration of the V(O2) on-kinetics is a marker of an improvement of absolute metabolic stability in skeletal muscles. The most frequently postulated factor responsible for enhancement of muscle metabolic stability is the training-induced increase in mitochondrial proteins. However, the mechanism proposed by Gollnick and Saltin (1982) can improve absolute metabolic stability only if training leads to a decrease in resting [ADP(free)]. This effect is not observed in many examples of training causing an acceleration of the V(O2) on-kinetics, especially in early stages of training. Additionally, this mechanism cannot account for the significant training-induced increase in the relative (expressed in % or as multiples of the resting values) metabolic stability at low work intensities, condition in which oxidative phosphorylation is not saturated with [ADP(free)]. Finally, it was reported that in the early stage of training, acceleration in the V(O2) on-kinetics and enhancement of muscle metabolic stability may precede adaptive responses in mitochondrial enzymes activities or mitochondria content. We postulate that the training-induced acceleration in the V(O2) on-kinetics and the improvement of the metabolite stability during moderate intensity exercise in the early stage of training is mostly caused by an intensification of the "parallel activation" of ATP consumption and ATP supply pathways. A further acceleration in V(O2) on-kinetics, resulting from prolonged periods of training, may be caused by a further and more pronounced improvement in the muscles' absolute metabolic stability, caused by an intensification of the "parallel activation" as well as by an increase in mitochondrial proteins. [Abstract/Link to Full Text]

Grassi B
Oxygen uptake kinetics: Why are they so slow? And what do they tell us?
J Physiol Pharmacol. 2006 Nov;57 Suppl 1053-65.
VO(2) kinetics and O(2) deficit are important determinants of exercise tolerance. In "normal" conditions convective and diffusive O(2) delivery to skeletal muscle fibers do not represent important determinants of VO(2) kinetics, whose limiting factors seem mainly located within muscle fibers. Whereas a limiting role by PDH has not been confirmed, the role of inhibition of mitochondrial respiration by NO needs further investigations. Important determinants of skeletal muscle VO(2) kinetics likely reside in the interplay between bioenergetic mechanisms at exercise onset. By acting as high-capacitance energy buffers, PCr hydrolysis and anaerobic glycolysis would delay or attenuate the increase in [ADP] within muscle fibers following rapid increases in ATP demand, preventing a more rapid activation of oxidative phosphorylation. The different "localization" of the main limiting factors for VO(2) kinetics and VO(2)max offers the opportunity to perform a functional evaluation of oxidative metabolism at two different levels of the pathway for O(2), from ambient air to mitochondria. Whereas VO(2)max is mainly limited by the capacity of the cardiovascular system to deliver O(2) to exercising muscles, by analysis of VO(2) kinetics the functional evaluation is mainly related to skeletal muscle. In pathological conditions the situation may be less clear, and warrants further investigations. [Abstract/Link to Full Text]

Petersen AM, Pedersen BK
The role of IL-6 in mediating the anti-inflammatory effects of exercise.
J Physiol Pharmacol. 2006 Nov;57 Suppl 1043-51.
Regular exercise offers protection against all cause mortality and there is evidence from randomised intervention studies that physical training is effective as a treatment in patients with chronic heart diseases, type 2 diabetes and symptoms related to the metabolic syndrome. Chronic diseases such as cardiovascular disease, type 2 diabetes and cancer are associated with chronic low-grade systemic inflammation. It has been demonstrated that regular exercise induces anti-inflammatory effects with elevated levels of anti-inflammatory cytokines and suppression of TNF-alpha production. Thereby, exercise offers protection against TNF-alpha-induced insulin resistance. Otherwise, the exercise-induced production and release of IL-6 from myofibers may contribute to abrogate an atherogenic lipid profile, which is often associated with chronic diseases. This review focuses on the anti-inflammatory effects of exercise and how this may contribute to mediate the beneficial health effects of exercise training in patients with chronic diseases associated with chronic low-grade inflammation. [Abstract/Link to Full Text]

Recent Articles in Polish Journal of Pharmacology and Pharmacy

Herba E, Pojda-Wilczek D, Plech AR, Pojda SM, Szkilnik R
Influence of dopamine on flash visual evoked potentials (FVEP) in prenatally mercury intoxicated rats.
Pol J Pharmacol. 2004 Jul-Aug;56(4):415-9.
The female adult white Wistar rats were given tap water (control) or 50 ppm of methylmercury chloride (MMC) ad libitum throughout their pregnancies. Newborn rats drank mother's milk during the first 21 days after delivery and then only tap water. The study was carried out on three-month old offsprings of white Wistar rats. The flash visual evoked potentials (FVEP) were recorded before and after injecting of 10 microl 0.9% saline, 50 or 100 nmols of dopamine (DA) into the lateral brain ventricle by method used before in our laboratory. The amplitude of the first deep negative (N(1)) peak significantly increased to 109-114% after both doses of DA in the control group and to 138-139% in mercury-treated animals. The amplitude of the next positive (P(1)) wave decreased to 94% and 86% in the control group after 50 and 100 nmols of DA, respectively. In Hg-treated group after 50 nmols of DA, the value dropped down to 91%, but increased to 109% after 100 nmols of DA. The increasing of DeltaN(1)P(1) was observed in the control group to 112% after 50 nmols and to 109% after 100 nmols of DA and in Hg-exposed rats, respectively, to 127% and to 129%. The described changes were statistically significant (p < 0.05). The N(1) and P(1) latencies were prolonged in the control group after both doses of DA. In Hg-treated group, the prolongation of N(1) latency was recorded, while the P(1) latency was not changed. We concluded that prenatal Hg intoxication disturbed the effect of DA on FVEP. [Abstract/Link to Full Text]

Zawilska JB, Rosiak J, Nowak JZ
Pertussis toxin-sensitive G protein modulates the ability of histamine to stimulate cAMP production in the chick pineal gland.
Pol J Pharmacol. 2004 Jul-Aug;56(4):407-13.
Histamine (HA) is a potent stimulator of cAMP synthesis in various structures of chick brain, including the pineal gland. The action of HA is mediated by specific, membrane bound H(2)-like receptors, whose pharmacological profile is different from that described for H(2) receptors in mammalian tissues. In this work, we analyzed the effects of cholera toxin (CTX) and pertussis toxin (PTX), well-known modulators of G(s) and G(i)/G(o) protein, respectively, on the stimulatory action of HA on cAMP synthesis in the chick pineal gland organ cultures. HA and its two biologically active methylated derivatives, 2-methylHA and 4-methylHA, markedly increased cAMP content in the chick pineal glands. Pretreatment of the chick pineal glands with CTX potently stimulated basal cAMP production. In CTX-pretreated glands, elevations of cAMP synthesis evoked by HA, 2-methylHA and 4-methylHA were additive to those produced by CTX, which is an observation suggesting that H(2)-like HA receptors in the chicken pineal gland are not coupled to G(s) proteins. Pretreatment of the chick pineal glands with PTX significantly enhanced the stimulatory effect of HA and, to a greater extent, 2-methylHA on cAMP production. The enhancing action of PTX on the HA-evoked cAMP formation was not modified by mepyramine, a selective H(1)-type HA receptor antagonist. It is suggested that in the chick pineal gland, a population of HA receptors is coupled to G(i) (or G(o)) protein. Stimulation of these receptors would tonically suppress the activity of the cAMP generating system functionally linked to H(2)-like HA receptors. [Abstract/Link to Full Text]

Wr�bel A, Nowak G, Ossowska G, Danilczuk Z, Zebrowska-?upina I, Wielosz M
Effect of chronic treatment with dexamethasone on brain dopamine receptors in mice.
Pol J Pharmacol. 2004 Jul-Aug;56(4):399-405.
Glucocorticoids are expressed in the central nervous system. Radioligand binding studies have shown their presence in the neurons of the limbic system, a structure involved in mood control and subtle regulation of hypothalamic-pituitary-adrenal (HPA) axis. Structures of the limbic system are also rich in dopaminergic innervation. It has been hypothesized that glucocorticoids may be important in causing and perpetuating depression. Our previous study has demonstrated that dexamethasone decreases the locomotor activity of mice and counteracts the hyperactivity induced by agonists of dopamine receptors. The aim of the present study was to find the possible mechanism responsible for these behavioral effects of dexamethasone. So we sought to examine the influence of chronic dexamethasone treatment on selective radioligand binding to dopamine D(1) ([(3)H]SCH 23390) and D(2) ([(3)H]spiperone) receptors in the brain of mice. The male Albino Swiss mice received dexamethasone (4, 8 or 16 mg/kg/day) for 14 days. The striatum and limbic system structures were isolated and the binding procedure was performed 3.5 or 48 h after the last injection. It was shown that 3.5 h after the last dose of dexamethasone (4 mg/kg/day), specific D(2) receptor binding was statistically significantly increased (by 64%) in the limbic system. On the contrary, the tendency to the reduction of specific D(2) receptor binding was observed in the striatum. Dexamethasone treatment did not influence the specific binding to D(1) receptors in any structure of the brain. [Abstract/Link to Full Text]

Bia?a G, Wegli?ska B
Calcium channel antagonists attenuate cross-sensitization to the locomotor effects of nicotine and ethanol in mice.
Pol J Pharmacol. 2004 Jul-Aug;56(4):391-7.
The present study was focused on evaluation of locomotor cross-sensitization between nicotine and ethanol in mice. First, we demonstrated that, after 5 daily injections, nicotine (0.5 mg/kg, ip) produced sensitization to its own locomotor stimulant effect. Moreover, nicotine-experienced mice manifested an enhanced response to ethanol challenge (2 g/kg, ip) indicating the development of cross-sensitization between nicotine and ethanol in mice. Additionally, the L-type voltage-dependent calcium channel antagonists: verapamil and diltiazem, but not nimodipine, at the dose of 20 mg/kg, injected before the ethanol challenge, blocked the expression of this cross-sensitization. These findings support the hypothesis that similar neural calcium-dependent mechanisms are involved in the sensitization to locomotor stimulant effects of nicotine and ethanol and point to certain differences in acute behavioral effects of various classes of calcium channel inhibitors. [Abstract/Link to Full Text]

Kostowski W, Bidzi?ski A, Krza?cik P, Szyndler J, Rok P, Ko?oma?ska P, Wis?owska A, Lehner M, P?a?nik A
Age-dependent effects of 5,7-dihydroxytryptamine on serotonin transporter in different brain areas in the rat.
Pol J Pharmacol. 2004 Jul-Aug;56(4):383-9.
In the present study, we investigated the [(3)H]citalopram binding using a quantitative autoradiography following intracerebroventricular injection of 5,7-dihydroxytryptamine (5,7-DHT) in neonatal and adult male Wistar rats. One group of animals was injected with 5,7-DHT at 3 days after birth while the second group received the neurotoxin at 3 months after birth. Control group was injected with saline. Afterwards, all rats were examined at 4(th) months after birth to determine the serotonin (5-HT) and catecholamines concentrations using the liquid chromatography with electrochemical detection HPLC system and distribution and density of [(3)H]citalopram binding sites in the brain using the quantitative autoradiography. A marked depletion of brain 5-HT was observed in rats lesioned either in postnatal or adult period of life. Rats lesioned in their adult period of life showed dramatic reduction of 5-HT transporter in all investigated brain areas (i.e.the frontal cortex, entorhinal cortex, hippocampus, caudate-putamen, nucleus accumbens and ventral tegmental area). On the other hand, administration of 5,7-DHT to newborn rats failed to reduce 5-HT transporter sites in the ventral tegmental area, and produced only slight or moderate reduction in the nucleus accumbens. Thus, it appears that the mesolimbic ventral tegmental area-nucleus accumbens systems are relatively more resistant to 5,7-DHT neurotoxicity in the early postnatal period. [Abstract/Link to Full Text]

Bielawski K, Wo?czy?ski S, Bielawska A
Inhibition of DNA topoisomerase I and II, and growth inhibition of MDA-MB-231 human breast cancer cells by bis-benzimidazole derivatives with alkylating moiety.
Pol J Pharmacol. 2004 May-Jun;56(3):373-8.
The purpose of the present study was to identify the cellular processes and targets affected by treatment with bis-benzimidazole derivatives with chloroalkyl and bromoalkyl moieties (1-4) in the estrogen receptor-negative MDA-MB-231 human breast cancer cells. Treatment of the cells revealed that these compounds inhibited DNA synthesis and irreversibly inhibited the proliferative activity of the cells. All drugs 1-4 inhibited relaxation of pBR 322 DNA induced by both topoisomerases, although topoisomerase I was 2- to 9-fold more sensitive than topoisomerase II. This suggests that DNA-binding may be implicated in the cytotoxicity of bis-benzimidazole derivatives with alkylating moiety, possibly by inhibiting interactions between topoisomerases and their DNA targets. [Abstract/Link to Full Text]

Mikov M, Kevresan S, Kuhajda K, Jakovljevi? V, Vasovi? V
3Alpha,7alpha-dihydroxy-12-oxo-5beta-cholanate as blood-brain barrier permeator.
Pol J Pharmacol. 2004 May-Jun;56(3):367-71.
The aim of the study was to test the efficacy of 3alpha,7alpha-dihydroxy-12-oxo-5beta-cholanate as a blood-brain barrier (BBB) permeator by examining its effect on quinine uptake into the central nervous system in rats, analgesic action of morphine, and on the sleeping time induced by pentobarbital. The obtained results indicate that sodium 3alpha,7alpha-dihydroxy-12-oxo-5beta-cholanate can be considered as modifier of BBB permeability, as it exhibited a promoting effect in all three tests. In the test of quinine uptake, methyl ester of 3alpha,7alpha-dihydroxy-12-oxo-5beta-cholanoic acid (included in the study for comparison) did not show a promoting effect, which can suggest its specific action. [Abstract/Link to Full Text]

Dyr W, Kostowski W
Preliminary phenotypic characterization of the Warsaw High Preferring (WHP) and Warsaw Low Preferring (WLP) lines of rats selectively bred for high and low ethanol consumption.
Pol J Pharmacol. 2004 May-Jun;56(3):359-65.
The Warsaw High Preferring (WHP) and Warsaw Low Preferring (WLP) lines were bred from Wistar foundation stock to obtain lines of rats that differ in their preference for ethanol (EtOH) solutions. The WHP line has met major criteria for an animal model of alcoholism. The WHP rats voluntarily drink excessive amounts of alcohol while the WLP rats consume negligible amounts of alcohol. These patterns of EtOH consumption are stable in time and independent of the manner of access to EtOH solutions. Notably, when exposed to the increasing EtOH concentrations both WHP and unselected Wistar rats gradually increased total EtOH intake. In contrast, WLP rats when exposed to the increasing concentrations of EtOH consumed almost negligible amounts of EtOH. Furthermore, the WHP rats show an increased responsiveness to the stimulatory effects of low dose of EtOH. [Abstract/Link to Full Text]

Kurt M, Bilge SS, Aksoz E, Kukula O, Celik S, Kesim Y
Effect of sildenafil on anxiety in the plus-maze test in mice.
Pol J Pharmacol. 2004 May-Jun;56(3):353-7.
Several studies have shown a role of nitric oxide/cyclic guanosine monophosphate signaling pathway in the regulation of anxiety. The effects of the phosphodiesterase (PDE) 5 inhibitors on anxiety are not fully understood. The aim of present study was to investigate the possible role of sildenafil, an inhibitor of cyclic GMP-specific phosphodiesterase, on anxiety in the plus-maze test in mice. Sildenafil at a dose of 0.5 mg/kg had no significant effect on the behavior in the plus-maze test but at doses of 1 and 3 mg/kg induced an anxiogenic effect. The combination of sildenafil (1 mg/kg, i.p.) and methylene blue (1 mg/kg, i.p.) abolished the anxiogenic-like effect of sildenafil. The combination of sildenafil (1 mg/kg, i.p.) and L-arginine (50 mg/kg, i.p.) decreased the percentage of time spent in open arms compared to saline-treated group. Diazepam at a dose of 2 mg/kg significantly increased the percentage of time spent in open arms (p < 0.05). Sildenafil at a dose of 3 mg/kg and the combination of L-arginine (50 mg/kg, i.p.) and sildenafil (1 mg/kg, i.p.) significantly decreased the locomotor activity (p < 0.05). These results suggest that a nitric oxide-cGMP pathway seems to play an important role in sildenafil-induced anxiogenic-like effect. [Abstract/Link to Full Text]

Pytlik M, Cegie?a U, Folwarczna J, Janiec W, Pytlik W
Effects of retinol on development of osteopenic changes induced by bilateral ovariectomy in rats.
Pol J Pharmacol. 2004 May-Jun;56(3):345-52.
Skeletal disorders occurring in experimental model of osteopenia caused by bilateral ovariectomy in rats are similar to those observed in postmenopausal women. Retinol is a commonly used vitamin, especially by elderly people. The role of retinol in bone remodeling is not well-established. The aim of the present study was to investigate the effect of retinol administered at doses of 700 IU/kg p.o. daily and 3500 IU/kg p.o. daily for 28 days on the development of osteopenia induced by bilateral ovariectomy in 3-month-old Wistar rats. The experiments were carried out on 4 groups of animals: I (C)--sham-operated control rats, II (OVX)--ovariectomized control rats, III (OVX + R700)--OVX rats treated with retinol (700 IU/kg p.o. daily), IV (OVX + R3500)--OVX rats treated with retinol (3500 IU/kg p.o. daily). Body mass gain, bone mass, mineral and calcium content in the tibia, femur and L-4 vertebra, histomorphometric parameters of the right tibia (width of osteoid, periosteal and endosteal transverse growth, the area of the transverse cross section of the bone marrow and cortical bone) and the right femur (width of epiphyseal and metaphyseal trabeculae, width of epiphyseal cartilage), and mechanical properties of the femur were investigated. Bilateral ovariectomy induced osteopenic skeletal changes in mature female rats. Retinol at doses of 700 IU/kg p.o. daily and 3500 IU/kg p.o. daily decreased bone mass (statistically significantly after treatment with 3500 IU/kg p.o. daily). Retinol at both doses caused statistically significant increases in the width of periosteal osteoid, and, at a dose of 3500 IU/kg p.o. daily, of endosteal osteoid. The increase in the width of osteoid may be the effect of disorder of its mineralization, as the decreases in bone mineral and calcium content were also noted. In mechanical tests of the femur, dose-dependent decreases in the ultimate load, the breaking load and the deformation caused by the applied load were observed after administration of retinol (in comparison with the OVX control rats). Concluding, retinol (especially administered at the dose of 3500 IU/kg daily) intensified the changes in the osseous system caused by estrogen deficiency in rats. [Abstract/Link to Full Text]

Folwarczna J, Janiec W, Barej M, Cegie?a U, Pytlik M, Kaczmarczyk-Sedlak I
Effects of nadroparin on bone histomorphometric parameters in rats.
Pol J Pharmacol. 2004 May-Jun;56(3):337-43.
Nadroparin calcium is a low-molecular-weight heparin. Low-molecular-weight heparins have a number of advantages over standard heparin (heparin), but it is not clear if low-molecular-weight heparins have less effect on bones than heparin. Administration of heparin can lead to osteoporosis. The aim of the present study was to investigate the effects of nadroparin on the rat osseous system and compare them with those of heparin. The experiments were carried out on female Wistar rats (13-15 weeks old at the beginning of the experiment), divided into 5 groups: I. Control, II. Nadroparin (1000 anti-Xa IU/kg s.c. daily), III. Nadroparin (2000 anti-Xa IU/kg s.c. daily), IV. Heparin (1000 IU/kg s.c. daily), V. Heparin (2000 IU/kg s.c. daily). Nadroparin and heparin were administered for 4 weeks. Bone mass, mineral and calcium content, macrometric and histomorphometric parameters (endosteal and periosteal transverse growth, width of endosteal and periosteal osteoid, transverse cross-section area of the cortical bone in the diaphysis and of the marrow cavity in the tibia, width of epiphyseal cartilage, width of trabeculae in the epiphysis and metaphysis in the femur) were examined. The effect of heparin on the ratio of bone mineral content to bone mass was more pronounced than that of nadroparin. Nadroparin caused unfavorable changes in the investigated bone histomorphometric parameters, similar to those caused by heparin. Nadroparin and heparin caused disorder of bone formation and intensification of bone resorption in rats. [Abstract/Link to Full Text]

Cegie?a U, Folwarczna J, Pytlik M, Janiec W
Effect of etoposide on the processes of osseous tissue remodeling in rats.
Pol J Pharmacol. 2004 May-Jun;56(3):327-36.
In the course of tumor metastases into bones, the process of resorption is intensified both as a result of direct influence of tumor cells on normal bone cells, and as a result of bone cell stimulation by cytokines and growth factors, which leads to pathological remodeling of osseous tissue and, in majority of cases, to the development of systemic hypercalcemia. Clinical observations and in vitro research show that also cytostatic drugs may disturb remodeling of bone tissue and cause osteopenia, mostly as a result of their direct effect on osteoblasts. The aim of this study was to investigate in vivo the effect of etoposide on the processes of bone tissue remodeling in rats by assessing macrometric and histomorphometric parameters, as well as mechanical properties of the femur. The tests were carried out on male Wistar rats of initial body mass between 280-310 g, which were divided into three groups (n = 8): I--control group of rats, which were given 0.9% NaCl solution every 7 days (C group), II--rats which were administered etoposide at the dose of 25 mg/kg p.o. every 7 days (E-25 group), III--rats which were given etoposide at one dose of 50 mg/kg i.v. (E-50 group). The experiment lasted 4 weeks. At the end of the experiment, the animals were killed by spinal cord displacement and the following values were determined: the mass, mineral and calcium content in the tested bones, length and diameter of long bones, transverse cross-section surface of tibial cortical bone and marrow cavity, transverse growth of the tibia and width of periosteal and endosteal osteoid in the tibia, as well as the width of osseous trabeculae, the width of epiphysial cartilage and mechanical properties of the femur. The tests showed that etoposide administered every 7 days at the dose of 25 mg/kg p.o. or at one dose of 50 mg/kg i.v. over the period of 28 days, disturbed osseous tissue remodeling processes in rats as a result of impeding the process of bone formation, which led to the impairment of the process of mineralization, weakening mechanical endurance of the femur, and to the development of osteopenia. [Abstract/Link to Full Text]

Kosik-Bogacka DI, Banach B, Tyrakowski T, Czarny T, Jodko ?
Effect of antagonists of adrenergic and cholinergic receptors on ion transport in the isolated rabbit caecum wall.
Pol J Pharmacol. 2004 May-Jun;56(3):319-25.
A hypothesis was tested in this study that antagonists of adrenergic and cholinergic receptors affect sodium and chloride ion transport in the rabbit caecum. A modified Ussing chamber was used in the experiment. It was demonstrated that isolated caecum responded to a mechanical stimulus, which consisted in gentle rinsing of the mucous surface, with changes in transepithelial electrical potential difference. An application of ion transport inhibitors, amiloride for sodium and bumetanide for chloride ions, demonstrated that both sodium and chloride ion transport in part determined the response. Pharmaceuticals that are antagonistic at neural receptors (alpha- and beta-adrenergic, nicotinic, and muscarinic), applied both for incubation and stimulation, reduced electrical potential and inhibited responses to mechanical stimuli. Basing on the results of this experiment and literature data, one can presume that analogical responses occur in vivo, and the physiological role of the autonomic system includes regulation of the thickness and consistence of mucus that separates fecal masses from the caecum walls. [Abstract/Link to Full Text]

Lorkowska B, Chlopicki S, Marcinkiewicz E, Gryglewski RJ
Statins rise cytoplasmic calcium level [Ca2+]i in cultured endothelial cells.
Pol J Pharmacol. 2004 May-Jun;56(3):313-8.
Recently, we have shown that some HMG-CoA reductase inhibitors (statins) induce immediate pleiotropic effects in vascular endothelium both in vivo and in vitro, to mention only PGI2-mediated thrombolysis in rats and NO-mediated endothelium-dependent vasodilation in guinea pig coronary circulation. Here we look whether immediate endothelial effect of statins is associated with mobilization of intracellular calcium ions [Ca2+]i in cultured bovine aortic endothelial cells (BAEC). We analyzed the effects of various statins (atorvastatin, cerivastatin, simvastatin, lovastatin and pravastatin at concentration of 10-30 microM) on [Ca2+]i in BAEC in comparison to responses induced by bradykinin (Bk) (10 nM), adenosine diphosphate (1 microM), acetylcholine (100 nM), adrenaline (10 microM), serotonin (10 microM) or calcium ionophore A 23187 (0.1 microM) using FURA-2 according to fluorimetric method of Grynkiewicz et al. Basal [Ca2+]i level in BAEC was between 60 and 100 nM. Bk was the most potent to induce [Ca2+]i response. Delta[Ca2+]i induced by Bk was 331.9 +/- 19.49 nM (n = 36). Delta[Ca2+]i induced by statins (30 microM), i.e. atorvastatin, cerivastatin, simvastatin, lovastatin and pravastatin were 66.4 +/- 7.38% (n = 6), 54.8 +/- 10.12% (n = 5), 58.8 +/- 13.9% (n = 8), 27.7 +/- 7.19% (n = 5) and 0% (n = 5) of the response induced by Bk (10 nM), respectively. In summary, all statins tested, except pravastatin, induce immediate increase in [Ca2+]i in endothelium. This pleiotropic activity of statins in endothelium, most likely not related to the inhibition of HMG-CoA reductase, may represent an intracellular correlate for the immediate release of NO and PGI2 by these drugs that was reported by us previously. [Abstract/Link to Full Text]

Ossowska G, Danilczuk Z, Klenk-Majewska B, Czajkowski L, Zebrowska-?upina I
Antidepressants in chronic unpredictable mild stress (CUMS)-induced deficit of fighting behavior.
Pol J Pharmacol. 2004 May-Jun;56(3):305-11.
Chronic unpredictable stress (CUS) is one of the behavioral models resembling in some respects (loss of normal aggresiveness) human depression. In the present study, consistent with the ethical principles for scientific experiments on animals, we have decided to modify the CUS procedure. In this new modified model named chronic unpredictable mild stress (CUMS), we have introduced mild stressor (14 h period of 45 degrees cage tilt) instead of one severe stressor (20 s exposure to electric footshock). The purpose of the present study was to determine whether this new procedure CUMS, similarly to CUS, affected the footshock-induced fighting behavior. We have also investigated the effect of antidepressant drugs with different pharmacological profiles (imipramine, mianserin, fluoxetine, moclobemide, tianeptine) and anxiolytic drug (oxazepam) on fighting behavior in rats submitted to CUMS. It was found that in rats subjected to CUMS procedure the number of fighting attacks was significantly reduced (by about 80%). Prolonged treatment (once daily, for 14 days) with imipramine (10 mg/kg/day), tianeptine (12.5 mg/kg/day), mianserin (10 mg/kg/day), moclobemide (50 mg/kg/day), fluoxetine (10 mg/kg/day), but not oxazepam (5 mg/kg/day) prevented the deficit in fighting behavior in rats subjected to CUMS. In conclusion, the results of the present study indicate that CUMS, similarly to CUS procedure, induced behavioral deficit in rats which was normalized by antidepressants with a different pharmacological profile. [Abstract/Link to Full Text]

Ossowska K, Pietraszek M, Wardas J, Wolfarth S
Potential antipsychotic and extrapyramidal effects of (R,S)-3,4-dicarboxyphenylglycine [(R,S)-3,4-DCPG], a mixed AMPA antagonist/mGluR8 agonist.
Pol J Pharmacol. 2004 May-Jun;56(3):295-304.
An involvement of glutamatergic transmission in schizophrenia has been postulated for several years. According to that view, hypofunction of NMDA receptors and a compensatory increase in glutamate release which overstimulates non-NMDA receptors contributes to psychotic symptoms. Therefore, potential antipsychotic drugs are searched for among compounds which block AMPA receptors and inhibit glutamate release. (R,S)-3,4-dicarboxyphenylglycine [(R,S)-3,4-DCPG] is a mixed antagonist of AMPA receptors and agonist of an autoreceptor, i.e. metabotropic glutamate receptor 8. The aim of the study was to look for putative antipsychotic properties of (R,S)-3,4-DCPG in the model of locomotor stimulation induced by amphetamine or phencyclidine in mice. Moreover, a risk of extrapyramidal side-effects induced by this compound was examined, as capability to induce catalepsy in the bar test and to increase the proenkephalin mRNA expression, measured autoradiographically in striatal slices by in situ hybridization. (R,S)-3,4-DCPG (80 mg/kg i.p.) decreased the amphetamine (2.5 mg/kg s.c.)-but not phencyclidine (3 mg/kg s.c.)-induced hyperactivity. That dose of (R,S)-3,4-DCPG did not decrease the spontaneous locomotor activity of mice. However, a dose of 100 mg/kg ip of that compound evoked catalepsy and enhanced the catalepsy and striatal proenkephalin mRNA expression induced by haloperidol (1-2 mg/kg i.p.). The study seems to suggest that (R,S)-3,4-DCPG may possess antipsychotic properties at doses close to those evoking extrapyramidal side-effects which speaks for its rather typical than atypical neuroleptic profile. [Abstract/Link to Full Text]

Borowicz KK, Piskorska B, Kimber-Trojnar Z, Ma?ek R, Sobieszek G, Czuczwar SJ
Is there any future for felbamate treatment?
Pol J Pharmacol. 2004 May-Jun;56(3):289-94.
Felbamate (2-phenyl-1,3-propanediol dicarbamate), a representative of novel antiepileptic drugs (AESs), proved to have broad-spectrum anticonvulsive activity. Particularly beneficial efficacy was found against partial seizures and Lennox-Gastaut syndrome. Therefore, felbamate started to be indicated not only as an adjunctive antiepileptic drug but also in monotherapy. Unfortunately, it was also evidenced that the drug may induce aplastic anemia or hepatic failure. The former complication was frequently described in patients with previously diagnosed hematopoetic disturbances. Thirty-four cases of well-documented bone marrow suppression, occurred fatal in thirteen cases. Subsequently, felbamate's usage was essentially restricted and at present felbamate is not a first-line AED. However, excluding anemia-prone individuals, new possibilities may open for felbamate position in add-on therapy of drug-resistant epilepsy. Experimental studies provide a good theoretical basis for this kind of treatment. [Abstract/Link to Full Text]

Trojnar MK, Wierzchowska-Cioch E, Krzyzanowski M, Jargie??o M, Czuczwar SJ
New generation of valproic acid.
Pol J Pharmacol. 2004 May-Jun;56(3):283-8.
Valproic acid (VPA) is one of four first-line antiepileptic drugs (AEDs) currently established in the long-term treatment of epilepsy. Despite VPA's wide spectrum of action, in some cases its use is limited due to specific pharmacokinetics and dangerous adverse effects. These include hepatotoxicity and teratogenecity. Such limitations account for intensive research that has been carried out in order to develop new analogues or derivatives of VPA. In our review, we focus on three out of a number of substances that have been lately under investigation: NPS 1776, valrocemide and DP-VPA. These potential AEDs present both good anticonvulsive and safety profiles and seem to be more potent than the original VPA. Clinical trials, which are now ongoing, will answer the question whether or not they could become second generation of VPA. [Abstract/Link to Full Text]

Molecular Basis of Neurological Disease and New Therapeutic Strategies. Warszawa, Poland, 28029 November 2003. Proceedings and abstracts.
Pol J Pharmacol. 2003 Sep-Oct;55(5):811-917. [Abstract/Link to Full Text]

Wieczorkiewicz-P?aza A, P?aza P, Maciejewski R, Czuczwar M, Przesmycki K
Effect of topiramate on mechanical allodynia in neuropathic pain model in rats.
Pol J Pharmacol. 2004 Mar-Apr;56(2):275-8.
Topiramate, unlike gabapentin, lamotrigine and tiagabine, resembles phenytoin and carbamazepine since it had been used as an antinociceptive drug in empirical treatment of neuropathic pain in humans, before its systemic and planned research was conducted in animal models of pain. Chronic administration of topiramate, at the dose of 50 mg/kg/day, significantly diminished the mechanical sensitivity and shortened the period of allodynia in the Seltzer mononeuropathy model in rats. [Abstract/Link to Full Text]

Uresin Y, Erba? B, Ozek M
Losartan may prevent the elevation of plasma glucose levels induced by chronic stress.
Pol J Pharmacol. 2004 Mar-Apr;56(2):271-3.
The effect of angiotensin II antagonist, losartan, on chronic stress-induced elevation of blood glucose levels was investigated in rats. Chronic immobilization stress caused an increase in blood glucose levels in rats. Administration of losartan (3 mg/kg, po) before stress exposure significantly prevented this increment. We suggest that losartan showed this effect by decreasing the excessive sympathetic response to stress. In conclusion, there is a relationship between stress, sympathetic nervous system, and renin-angiotensin system. [Abstract/Link to Full Text]

Kopff M, Kowalczyk E, Kopff A
Influence of selected cardiological drugs on oxidative status.
Pol J Pharmacol. 2004 Mar-Apr;56(2):265-9.
The aim of the study was to determine the effect of the often applied drugs in cardiovascular diseases (metoprolol, acetylsalicylic acid, simvastatin and molsidomine) on antioxidative/oxidative balance in vivo. The determination of oxidative status was based on measurements of concentration of: thiobarbituric acid reactive substances (TBARS - lipid peroxidation products), protein carbonyl groups (marker of proteins oxidative injury), nitrotyrosine (marker of NO-mediated tissue damage) and sulfhydryl groups (protein oxidation product). The assays were performed in the plasma and whole blood of rabbits after three weeks of daily intragastric administration of the drugs mentioned above. It was shown that all drugs except acetylsalicylic acid caused an increase in the plasma and hemolysate levels of TBARS. No changes in nitrotyrosine concentration were observed after drug administration. The content of carbonyl groups did not change after administration of metoprolol, but increased significantly after simvastatin and molsidomine administration. Blood sulfhydryl group concentration was not changed by metoprolol but it significantly decreased after acetylsalicylic acid and increased significantly after molsidomine administration. [Abstract/Link to Full Text]

Kr�licki A, Klimowicz A, Bielecka-Grzela S, Nowak A, Maleszka R
Penetration of cotrimoxazole components into skin after a single oral dose. Theoretical versus experimental approach.
Pol J Pharmacol. 2004 Mar-Apr;56(2):257-63.
Concentrations of trimethoprim and sulfamethoxazole in plasma, cantharidin-induced skin blister fluid and theoretical peripheral compartment were determined in twelve male subjects suffering from bacterial skin diseases after a single oral dose of 0.32 g of trimethoprim and 1.6 g of sulfamethoxazole. Maximum trimethoprim concentrations of 8.5 +/- 1.1 micromol/l in plasma, 5.6 +/- 0.8 micromol/l in blister fluid and 5.8 +/- 2.2 micromol/l in theoretical peripheral compartment were found after 3 +/- 1, 7 +/- 2 and 9 +/- 6 h, respectively. Degree of penetration into blister fluid and theoretical peripheral compartment was 0.94 +/- 0.23 and 1.05 +/- 0.09, respectively. The differences between respective pharmacokinetic parameters of trimethoprim in blister fluid and theoretical peripheral compartment were statistically insignificant. Maximum sulfamethoxazole concentrations of 295 +/- 47 micromol/l in plasma, 182 +/- 46 micromol/l in blister fluid and 239 +/- 58 micromol/l in theoretical peripheral compartment were found after 3 +/- 1, 8 +/- 2 and 7 +/- 4 h, respectively. Degree of penetration into blister fluid and theoretical peripheral compartment was 0.82 +/- 0.20 and 1.04 +/- 0.02, respectively. In contrast to trimethoprim, the differences between respective pharmacokinetic parameters of sulfamethoxazole in blister fluid and theoretical peripheral compartment, except time to maximum concentration, were statistically significant. Cantharidin-induced skin blister fluid method can be used to estimate drug penetration into skin. Due to differences between the respective pharmacokinetic parameters in experimental and theoretical peripheral compartment, in some cases evaluation of drug penetration into skin should not be replaced by the theoretical peripheral compartment calculation. [Abstract/Link to Full Text]

Roma?ski KW
Ovine model for clear-cut study on the role of cholecystokinin in antral, small intestinal and gallbladder motility.
Pol J Pharmacol. 2004 Mar-Apr;56(2):247-56.
Cholecystokinin (CCK) is one of the major gastrointestinal hormones involved in the control of digestive tract and gallbladder motility. Its action involves several mechanisms. The ovine model was developed in order to further explore the role of CCK in gastric, small intestinal and gallbladder motility under various experimental conditions. Five Merino sheep were used with bipolar electrodes implanted to their antrum, entire small intestine and gallbladder as well as strain gauge force transducers were attached to the duodenum and gallbladder fundus, near the electrodes. In the course of chronic experiments, the myoelectric and motor activity were recorded by means of the adapted electroencephalograph. Among the variety of CCK-octapeptide or cerulein doses, three doses of each CCK peptide were selected and then applied for various time periods. Finally, the effects of the hormones administered within 30 s during phase 2 of the same or different migrating myoelectric complexes (MMCs) on gastrointestinal and gallbladder myoelectric and motor activity were studied in fasted and non-fasted animals. Injection of the highest dose inhibited rumination in four of the five sheep and inhibited phase 3 MMC in the antroduodenal region. Hormone administration inhibited dose-dependently antral myoelectric activity. The effects of moderate dose of both CCK peptides on myoelectric activity of the duodeno-jejunum was usually opposite (i.e. stimulatory) than that of the ileum. Gallbladder response to CCK peptides exhibited mostly the tonic character, and in some experiments, the slow wave frequency and amplitude were altered. It is concluded that CCK acts on several targets and different mechanisms underlie its multiple actions on gastrointestinal and gallbladder motility in sheep. [Abstract/Link to Full Text]

Velmurugan B, Santhiya ST, Nagini S
Protective effect of S-allylcysteine and lycopene in combination against N-methyl-N'-nitro-N-nitrosoguanidine-induced genotoxicity.
Pol J Pharmacol. 2004 Mar-Apr;56(2):241-5.
Chemoprotection by diet-derived antioxidants has emerged as a cost-effective approach in preventing genotoxicity and carcinogenicity. In this study, we investigated the protective effects of S-allylcysteine (SAC) and lycopene against N-methyl-N'-nitro-N-nitrosoguanidine (MNNG)-induced genotoxicity. Quantification of bone marrow micronuclei and chromosomal aberrations in male Wistar rats was used to monitor the protective effects of SAC and lycopene. Intragastric administration of MNNG (40 mg/kg) induced a significant increase in the frequency of micronuclei and chromosomal aberrations. Although pretreatment with SAC and lycopene significantly reduced the frequency of MNNG-induced bone marrow micronuclei and chromosomal aberrations, the combination of SAC and lycopene exerted a greater protective effect. These findings indicate that antioxidants such as SAC and lycopene, are effective chemoprotective agents against genotoxicity and carcinogenicity especially when used in combination. [Abstract/Link to Full Text]

Aruna K, Rukkumani R, Sureshvarma P, Menon VP
Role of an aminothiazole derivative on ethanol- and thermally oxidized sunflower oil-induced toxicity.
Pol J Pharmacol. 2004 Mar-Apr;56(2):233-40.
It is a known fact that ethanol increases lipid levels in humans and experimental animals. In this study, we have investigated the effect of dendrodoine analogue (DA), DA-[4-amino-5-benzoyl-2-(4-methoxyphenylamino)-thiazole], on alcohol- and thermally oxidized sunflower oil-induced hyperlipidemia. Ethanol was given to animals at a dose of 5 ml of 20% solution and thermally oxidized sunflower oil at a level of 15% (15 g oil/100 g feed). Our results showed increased activity of aspartate transaminase (AST), alkaline phosphatase (ALP) and gamma-glutamyl transferase (GGT) and increased levels of cholesterol, triglycerides and phospholipids in the plasma of groups given alcohol, thermally oxidized oil and alcohol + thermally oxidized oil when compared with normal control group. The levels of tissue (liver and kidney) cholesterol and triglycerides were increased significantly in groups treated with alcohol, thermally oxidized oil and alcohol + thermally oxidized oil when compared with normal control rats. The levels were decreased when DA was given along with alcohol and thermally oxidized oil. The level of phospholipids decreased significantly in the liver and kidney of rats administered alcohol, thermally oxidized oil and alcohol + thermally oxidized oil when compared with normal control rats. The level increased when DA was administered along with alcohol and thermally oxidized oil. The activity of phospholipase A and C increased significantly in the liver of groups given alcohol, thermally oxidized oil and alcohol + thermally oxidized oil when compared with normal control rats, whereas the activity was decreased upon DA treatment. The obtained results indicate that DA can decrease the lipid levels in alcohol- and thermally oxidized oil-treated rats. [Abstract/Link to Full Text]

Borba-Murad GR, Vardanega-Peicher M, Galende SB, Curi R, Souza HM, Mario EG, Bassoli BK, Bazotte RB
Central role of cAMP in the inhibition of glycogen breakdown and gluconeogenesis promoted by leptin and insulin in perfused rat liver.
Pol J Pharmacol. 2004 Mar-Apr;56(2):223-31.
Leptin showed less prominent inhibiting effect on the activation of hepatic glycogen breakdown and gluconeogenesis promoted by cAMP. The role of cAMP in the inhibition of glycogen breakdown and gluconeogenesis induced by physiological levels of leptin (10 ng/ml) and insulin (20 microU/ml) in the perfused liver was investigated. Insulin but not leptin inhibited (p < 0.05) the activation of glycogen breakdown promoted by cAMP (3 microM). Contrary to cAMP, the activation of glycogen catabolism promoted by 8-Br-cAMP (0.3 microM), a cAMP analogue more resistant to hydrolysis by phosphodiesterase 3B (PD3B), was inhibited (p < 0.05) not only by insulin (20 microU/ml) but also by leptin (10 ng/ml). The effect of leptin, however, was less intense than that of insulin. To verify the participation of the intracellular levels of cAMP, the experiments were repeated with N(6)-monobutyryl-cAMP (N(6)-MB-cAMP), a cAMP analogue, which is not metabolized by PD3B. The activation of glycogen breakdown promoted by N(6)-MB-cAMP (0.3 microM) was not affected by leptin or insulin. In agreement with the results regarding glycogen catabolism, insulin and leptin at 50 ng/ml but not leptin at 10 ng/ml inhibited (p < 0.05) the activation of gluconeogenesis promoted by cAMP (7.5 microM). Taken together, these results led us to postulate that the convergent signaling pathways of these two hormones causing the inhibition of glycogen catabolism and gluconeogenesis involve a reduction of intracellular cAMP. Thus, cAMP levels may play an important role in the cross talk between both hormones and for the insulin-like effects of leptin. [Abstract/Link to Full Text]

Be?towski J, Jamroz-Wi?niewska A, Borkowska E, W�jcicka G
Up-regulation of renal Na+, K+-ATPase: the possible novel mechanism of leptin-induced hypertension.
Pol J Pharmacol. 2004 Mar-Apr;56(2):213-22.
Hyperleptinemia may be involved in the pathogenesis of obesity-associated hypertension, however, the mechanism of hypertensive effect of leptin has not been elucidated. We investigated the effect of experimental hyperleptinemia on renal function, renal Na(+), K(+)-ATPase and ouabain-sensitive H(+), K(+)-ATPase activities in the rat. Leptin administered for 7 days (0.25 mg/kg twice daily sc) decreased food intake on 6th and 7th day of treatment but had no effect on body weight. Systolic blood pressure was 30.5% higher in leptin-treated animals. Urinary excretion of sodium decreased by 35.0% following leptin treatment. Leptin had no effect on potassium and phosphate excretion as well as on creatinine clearance. The activity of Na(+), K(+)-ATPase in the renal cortex and medulla was higher in leptin-treated rats by 32.4% and 84.2%, respectively. In contrast, leptin had no effect on either cortical or medullary ouabain-sensitive H(+), K(+)-ATPase. In pair-fed group, in which food intake was reduced to the level observed in leptin-treated group, no changes in sodium metabolism and renal Na(+), K(+)-ATPase were observed. Leptin decreased urinary excretion of nitric oxide metabolites by 55.0% and urinary excretion of cGMP by 26.3%. Plasma concentration of atrial natriuretic peptide tended to be higher and urinary excretion of urodilatin was 64.9% higher in leptin-treated animals. These data suggest that hyperleptinemia decreases natriuresis by up-regulating Na(+), K(+)-ATPase and stimulating tubular sodium reabsorption. This effect is mediated, at least in part, by deficiency of nitric oxide (NO). Abnormal renal sodium retention and vasoconstriction associated with NO deficiency may contribute to leptin-induced hypertension and to blood pressure elevation in hypertensive obese individuals. [Abstract/Link to Full Text]

Zawilska JB, Niewiadomski P, Nowak JZ
Receptors for vasoactive intestinal peptide and pituitary adenylate cyclase-activating polypeptide in the goose cerebral cortex.
Pol J Pharmacol. 2004 Mar-Apr;56(2):203-11.
Receptors for vasoactive intestinal peptide (VIP) and pituitary adenylate cyclase-activating polypeptide (PACAP) in the goose cerebral cortex were characterized using two approaches: (1) in vitro radioreceptor binding of [(125)I]-VIP, and (2) effects of peptides from the VIP/PACAP/secretin family on cyclic AMP formation. The binding of [(125)I]-VIP to goose cortical membranes was rapid, stable, and reversible. Saturation analysis resulted in a linear Scatchard plot, suggesting binding to a single class of receptor binding sites with a high affinity (K(d)=0.76 +/- 0.13 nM) and high capacity (B(max)=70 +/- 7 fmol/mg of protein). Various peptides displaced the specific binding of 0.12 nM [(125)I]-VIP to the goose cerebral cortical membranes in a concentration-dependent manner. The relative rank order of potency of the tested peptides to inhibit [(125)I]-VIP binding to the goose cerebrum was: PACAP(38) asymptotically equal to mammalian VIP > or = PACAP(27) asymptotically equal to chicken VIP > PHI (peptide histidine-isoleucine) > secretin (inactive). About 52% of specific [(125)I]-VIP binding sites in the goose cerebral cortex was sensitive to 5'-guanylimidodiphosphate [Gpp(NH)p], a nonhydrolyzable analogue of GTP. PACAP(38) and PACAP(27) potently stimulated cyclic AMP formation in the goose cerebral cortical slices in a concentration-dependent manner, displaying EC(50) values of 45.5 nM and 51.5 nM, respectively. Chicken VIP was markedly less potent than both forms of PACAP, mammalian VIP only weakly affected the nucleotide production, while effects evoked by PHI were negligible. It is concluded that the cerebral cortex of goose contains VPAC type receptors that are labeled with [(125)I]-VIP and are positively linked to cyclic AMP formation. In addition, the observed stronger action of PACAP, when compared to VIP, on cyclic AMP production in this tissue suggests its interaction with both PAC(1) and VPAC receptors. [Abstract/Link to Full Text]

Sobaniec W, Ku?ak W, Smigielska-Kuzia J, Bo?kowski L, Majkowski J, Jedrzejczak J
A multicenter, placebo-controlled, double-blind study of efficacy of a new form of carbamazepine (Carbatrol) in refractory epileptic patients.
Pol J Pharmacol. 2004 Mar-Apr;56(2):195-201.
Carbatrol (CBR) is a new multiple-unit, sustained-release dosage form of carbamazepine (CBZ) developed by Pharmavene. We present a multicenter, outpatient, randomized, double-blind parallel group study (No PI 101) carried out in two centers in Poland. CBR was evaluated in 47 patients with uncontrolled partial onset seizures. During the 28-day baseline period, patients were required to have at least two seizures and to take CBZ at a therapeutic level, a second antiepileptic drug was allowed but not valproic acid (VPA ). Patients were randomized to VPA or to CBR (dosages 800, 1200, 1600 mg/day). Criteria for escape relative to baseline were: two-fold increase in monthly seizure frequency, two-fold increase in 2-day seizure frequency, two-fold increase in weekly seizure frequency, single generalized tonic-clonic seizure (GTCs) if none occurred during baseline or prolongation of GTCs. The primary efficacy variable was the number of patients escaping in each treatment group. Nineteen patients on VPAand 7 on CBR met escape criteria. CBR adverse experiences were all mild or moderate in severity. CBR therapy was effective in the treatment of partial complex seizures with or without generalization. [Abstract/Link to Full Text]

Recent Articles in Acta Pharmacologica Sinica

Liao QC, Xiao ZS, Qin YF, Zhou HH
Genistein stimulates osteoblastic differentiation via p38 MAPK-Cbfa1 pathway in bone marrow culture.
Acta Pharmacol Sin. 2007 Oct;28(10):1597-602.
AIM: To test the hypothesis that genistein stimulates the osteoblastic differentiation through the p38 mitogen activated protein kinase (MAPK)-core-binding factor 1 (Cbfa1) pathway. METHODS: The activation of p38 MAPK was detected by Western blotting. Alkaline phosphatase (ALP) activity and calcium deposition were assessed for osteoblastic differentiation of bone marrow-derived mesenchymal stem cell (BMSC) cultures. The expression of Cbfa1 was analyzed at both the mRNA and protein levels. The activity of Cbfa1 was detected by electrophoretic mobility shift assay. Bone sialoprotein (BSP), ALP, osteocalcin (OC), and osteopontin (OPN) gene transcription were also evaluated by either RT-PCR or Northern blotting. RESULTS: Genistein (0.01-1 micromol/L) dose dependently led to the rapid and sustained activation of the p38 MAPK pathway in mouse BMSC cultures. Treatment with genistein (1 micromol/L) resulted in increased ALP activity and calcium deposition of BMSC cultures as a function of time. Genistein also enhanced Cbfa1 DNA binding activity and promoted the expressions of Cbfa1 itself as well as several Cbfa1-regulated genes, including ALP, BSP, OC, and OPN. Concurrent treatment with p38 MAPK inhibitor (SB203580) diminished the genistein-induced osteoblastic maturation and p38 MAPK-Cbfa1 activation in mouse BMSC cultures. CONCLUSION: These results indicated that genistein could stimulate the osteoblastic differentiation of BMSC cultures through the p38 MAPK-Cbfa1 pathway. [Abstract/Link to Full Text]

Xu FZ, Chen C, Zhang YH, Ruan HL, Pi HF, Zhang P, Wu JZ
Synthesis and antitussive evaluation of verticinone-cholic acid salt, a novel and potential cough therapeutic agent.
Acta Pharmacol Sin. 2007 Oct;28(10):1591-6.
AIM: To seek a novel and potent antitussive drug based on Shedan-Chuanbei powder, a complex of traditional Chinese medicine preparation for cough therapy. METHODS: Verticinone-cholic acid (Ver-CA) salt, a novel, salifying derivative of verticinone and cholic acid, both of which are the major bioactive components in Shedan-Chuanbei powder, was synthesized. We then evaluated the antitussive activity and the acute toxicity of the salt. RESULTS: The new compound, with good solubility in water, has much more potent antitussive activity in comparison with the same dose of single verticinone and single cholic acid. The administration 3 mg/kg of Ver-CA could result in over 50% reduction of a citric acid-induced cough. Pretreatment with naloxone (0.8 mg/kg, ip) can only partially antagonize its antitussive effect. On the other hand, glybenclamide (3 mg/kg, ip), an ATP-sensitive K+ channel blocker, can also significantly reduce the antitussive effect of Ver-CA. A further acute toxicity study showed that the LD(50) values of Ver-CA were 3 times that of verticinone. CONCLUSION: Based on the studies of pharmacology and acute toxicity, the salt has a synergic and attenuated toxicity compared with single verticinone and cholic acid. Moreover, the present study also suggests that Ver-CA, a potential novel antitussive agent, may exert its antitussive effect via both the peripheral (modulated by ATP-sensitive K+ channels) and central mechanisms (modulated by the opioid receptor). [Abstract/Link to Full Text]

Zhou GJ, Zhang H, Zhi SD, Jiang GP, Wang J, Zhang M, Gan JX, Xu SW, Jiang GY
Protective effect of raloxifene on lipopolysaccharide and acid- induced acute lung injury in rats.
Acta Pharmacol Sin. 2007 Oct;28(10):1585-90.
AIM: To evaluate the protective effect of oral raloxifene on acute lung injury. METHODS: Thirty adult, male Sprague-Dawley rats each weighing 180-210 g were used and divided into 3 groups: the raloxifene-lipopolysaccharide (LPS)-HCl group (n=10), the LPS-raloxifene-HCl group (n=10), and the placebo group (n=10). All the rats were injected intraperitoneally (ip) with 5 mg/kg LPS, and raloxifene (30 mg/kg) was orally administered 1 h before and 14 h after LPS injection into the raloxifene-LPS-HCl and the LPS-raloxifene-HCl groups, respectively; the placebo group received nothing. Sixteen hours after LPS injection, all the animals were anesthetized and the femoral artery was cannulated. All the rats received a direct intratracheal (IT) injection of HCl (pH 1.2; 0.5 mL/kg). The mean arterial pressure (MAP) and blood gas concentrations were measured. Fifteen rats (5 in each group, respectively) underwent a micro positron emission tomography (microPET) scan of the thorax 4 h after HCl instillation. The wet/dry (W/D) weight ratio determination and histopathological examination were also performed. RESULTS: The rats in the LPS-raloxifene-HCl group had a lower [18F]fluorodeoxyglucose uptake compared with the rats in the placebo group (4.67+/-1.33 vs 9.01+/-1.58, respectively, P<0.01). The rats in the LPS-raloxifene-HCl group also had a lower histological lung injury score (8.20+/-1.23 vs 12.6+/-0.97, respectively, P<0.01) and W/D weight ratio (5.335+/-0.198 vs 5.886+/-0.257, respectively, P<0.01) compared to the placebo group. The rats in this group also showed better pulmonary gas exchange and more stable mean arterial pressure (MAP) compared to the placebo group. CONCLUSION: Raloxifene provides a significant protective effect on acute lung injury in rats induced first by LPS ip injection and then by HCl IT instillation. [Abstract/Link to Full Text]

Sun HH, Chen Q, Lin X, Chen JS, Qiu PX, Yan GM
Purification and partial characterizations of coagulant protein FIa from Daboia russelli siamensis (Myanmar) venom.
Acta Pharmacol Sin. 2007 Oct;28(10):1580-4.
AIM: To purify and characterize the coagulant protein FIa from Daboia russelli siamensis (Myanmar) venom. METHODS: FIa was purified from Daboia russelli siamensis (Myanmar) venom by ion-exchange chromatography on CM-Sephadex C-50, and gel filtration on Sephadex G-75 and a Superdex 75 column. The hemostatic activity of FIa was determined by the method of Williams and Esnouf. The specific chromogenic substrates were used respectively to determine the activation of factor X and prothrombin. The fibrinogen-clotting activity of FIa was determined by the method of Gao et al. Normal saline was used as a negative control while factor Xa and thrombin were used as positive controls, respectively. RESULTS: FIa, a coagulant protein, was achieved by ion-exchange chromatography and gel filtration with a molecular weight of 34,479 and an isoelectric point of 7.2. FIa was shown to have strong hemostatic activity. The hemostatic activity of 0.5 mg FIa was equal to that of 1.5625 u thrombin. FIa primarily activated factor X, however, had no influence on prothrombin, nor did it cleave or clot fibrinogen. CONCLUSION: FIa is a factor X-activating enzyme, which could activate factor X to factor Xa, but has no effect on prothrombin and fibrinogen. [Abstract/Link to Full Text]

Xu W, Zha RP, Wang WY, Wang YP
Effects of scutellarin on PKCgamma in PC12 cell injury induced by oxygen and glucose deprivation.
Acta Pharmacol Sin. 2007 Oct;28(10):1573-9.
AIM: To evaluate the neuroprotective effect and mechanisms of scutellarin (Scu) against PC12 cell injury after oxygen and glucose deprivation followed by reperfusion (OGD-Rep). METHODS: Undifferentiated rat pheochromocytoma PC12 cells, exposed to oxygen and glucose deprivation followed by reperfusion (OGD-Rep), used as an in vitro model of ischemia/reperfusion. Cell survival was evaluated by diphenyltetrazolium bromide (MTT) assay and the amount of LDH release was determined using assay kits. [Ca2+](i) was monitored using a fluorescent Ca2+-sensitive dye Fura-2 acetoxymethyl ester. Cell apoptosis was detected by a DNA ladder and by flow cytometric detection. The expression of protein kinase C (PKC)gamma was determined using both RT-PCR and Western blotting. The translocation of PKCgamma was assayed by subcellular fractionation and Western blotting. RESULTS: OGD-Rep injury significantly elevated the level of LDH release, [Ca2+](i), mRNA expression and the translocation of PKCgamma compared in the PC12 cells with those of the normal group. Scu (10-100 micromol/L) exerted a protective effect against OGD-Rep injury by reducing LDH release, [Ca2+](i), the percent of apoptosis, and the translocation of PKCgamma. CONCLUSION: Scu inhibits the increase of [Ca2+](i) and the activation of PKCgamma, exerting protective effects against PC12 cell injury induced by OGD-Rep. [Abstract/Link to Full Text]

Anozie O, Ross R, Oyekan AO, Yakubu MA
Differential modulation of bradykinin-induced relaxation of endothelin-1 and phenylephrine contractions of rat aorta by antioxidants.
Acta Pharmacol Sin. 2007 Oct;28(10):1566-72.
AIM: We tested the hypothesis that bradykinin (BK)-induced relaxation of phenylephrine (PE) and endothelin-1 (ET-1) contractions can be differentially modulated by reactive oxygen species (ROS). METHODS: Aortic rings isolated from Sprague-Dawley rats were used for the study. The contribution of ROS to PE (1 x 10(-9)-1 x 10(-5) mol/L)- and ET-1 (1 x 10(-10)-1 x 10(-8) mol/L)-induced contractions and the influence of ROS in BK (1 x 10(-9)-1 x 10(-5) mol/L) relaxation of PE (1 x 10(-7) mol/L) or ET-1 (1 x 10(-9) mol/L)-induced tension was evaluated in the aorta in the presence or absence of the following antioxidants: catalase (CAT, 300 U/mL), superoxide dismutase (SOD, 300 U/mL), and vitamin C (1 x 10(-4) mol/L). Results: Tension generated by ET-1 (1 x 10(-9) mol/L) or PE (1 x 10(-7) mol/L) was differentially relaxed by BK (1 x 10(-5) mol/L), producing a maximal relaxation of 75%+/-5% and 35+/-4%, respectively. The BK (1 x 10(-5) mol/L)-induced relaxation of PE (1 x 10(-7) mol/L) tension was significantly enhanced from 35%+/-4% (control) to 56%+/-9%, 60%+/-5%, and 49%+/-6% by SOD, CAT, and vitamin C, respectively (P<0.05, n=8). However, the relaxation of ET-1 (1 x 10(-9) mol/L) tension was significantly attenuated from 75%+/-5% (control) to 37%+/-9%, 63%+/-4%, and 39%+/-7% by SOD, CAT, and vitamin C, respectively (P<0.05, n=8). On the other hand, CAT had no effect on PE-induced tension, while SOD enhanced PE-induced tension (36%, P<0.05, n=10) and vitamin C attenuated (66%, P<0.05, n=8) the tension induced by PE. By contrast, SOD or vitamin C had no effect, but CAT attenuated (44%, P<0.05, n=9) the tension induced by ET-1. CONCLUSION: We have demonstrated that O2(-) and H2O2 differentially modulate BK relaxation in an agonist-specific manner. O2(-) attenuates BK-induced relaxation of PE contraction, but contributes to the relaxation of ET-1 contraction. O2(-) seems to inhibit PE contraction, while H2O2 contributes to ET-1-induced contraction. Thus, ROS differentially modulate vascular tone depending on the vasoactive agent that is used to generate the tone. [Abstract/Link to Full Text]

Chiu PY, Leung HY, Siu AH, Poon MK, Ko KM
Schisandrin B decreases the sensitivity of mitochondria to calcium ion-induced permeability transition and protects against ischemia-reperfusion injury in rat hearts.
Acta Pharmacol Sin. 2007 Oct;28(10):1559-65.
Aim: In order to elucidate the molecular mechanism underlying the cardioprotection afforded by schisandrin B (Sch B), the effect of Sch B treatment on the sensitivity of mitochondria to Ca2+-stimulated permeability transition (PT) was investigated in rat hearts under normal and ischemia-reperfusion (I-R) conditions. Results: Myocardial I-R injury caused an increase in the sensitivity of mitochondria to Ca2+-stimulated PT in vitro. The enhanced sensitivity to mitochondrial PT was associated with increases in mitochondrial Ca2+ content as well as the extent of reactive oxidant species production in vitro and cytochrome c release in vivo. The cardioprotection afforded by Sch B pretreatment against I-R-induced injury was paralleled by the decrease in the sensitivity of myocardial mitochondria to Ca2+-stimulated PT, particularly under I-R conditions. Conclusion: The results suggest that Sch B treatment increases the resistance of myocardial mitochondria to Ca2+-stimulated PT and protects against I-R-induced tissue injury. [Abstract/Link to Full Text]

Ma XJ, Shen FM, Liu AJ, Shi KY, Wu YL, Su DF
Clonidine, moxonidine, folic acid, and mecobalamin improve baroreflex function in stroke-prone, spontaneously hypertensive rats.
Acta Pharmacol Sin. 2007 Oct;28(10):1550-8.
AIM: To investigate the effect of clonidine, moxonidine, folic acid, and mecobalamin on arterial baroreflex (ABR) function in stroke-prone spontaneously hypertensive rats (SHR-SP) and the possible mechanisms involved. METHODS: Eighty-one SHR-SP were divided into 7 groups. Four groups were designated for the intragastric (ig) administration of clonidine (1.0 and 10.0 microg/kg), moxonidine (0.1 and 1.0 mg/kg), folic acid (1.0 mg/kg), and mecobalamin (1.0 mg/kg). Three groups were for the intracerebroventricular (icv) injection of clonidine (4 microg/4 microL), moxonidine (5 microg/4 microL), and mecobalamin (20 microg/4 microL). Blood pressure (BP) was recorded in the conscious state for 30 min and baroreflex sensitivity (BRS) was determined respectively before and after drug administration. RESULTS: Clonidine and moxonidine significantly decreased BP, prolonged the heart period (HP), and increased BRS when administered as either ig or icv injections. Both BP and HP were unchanged by ig folic acid or mecobalamin injection. However, BRS was significantly increased by both. CONCLUSION: Clonidine, moxonidine, folic acid, and mecobalamin improved impaired ABR function in SHR-SP. The central mechanism was involved in this effect of either clonidine or moxonidine. Mecobalamin improved ABR function through the peripheral mechanism. [Abstract/Link to Full Text]

Ding L, Liang XG, Zhu DY, Lou YJ
Icariin promotes expression of PGC-1alpha, PPARalpha, and NRF-1 during cardiomyocyte differentiation of murine embryonic stem cells in vitro.
Acta Pharmacol Sin. 2007 Oct;28(10):1541-9.
AIM: To investigate the effect of icariin on the expression of peroxisome proliferator-activated receptor gamma coactivator-1 alpha (PGC-1alpha), peroxisome proliferator-activated receptor alpha (PPARalpha), and nuclear respiratory factor 1 (NRF-1) on cardiomyocyte differentiation of murine embryonic stem (ES) cells in vitro. METHODS: The cardiomyocytes derived from murine ES cells were verified by immunocytochemistry using confocal laser scanning microscopy. Cardiac-specific sarcomeric proteins (ie alpha-actinin, troponin T) were evaluated when embryoid bodies (EB) were treated with icariin or retinoid acid. The expression of PGC-1alpha, PPARalpha, and NRF-1 were analyzed using both semiquantitative RT-PCR and Western blotting in cardiomyocyte differentiation. The phosphorylation of the p38 mitogen-activated protein kinase (MAPK) was studied in the differentiation process, and its specific inhibitor SB203580 was employed to confirm the function of the p38 MAPK on icariin-induced cardiac differentiation. RESULTS: The application of icariin significantly induced the cardiomyocyte differentiation of EB as indicated by the promoted expression of alpha-actinin and troponin T. The expression of PGC-1alpha, PPARalpha, and NRF-1 increased coincidently in early differentiation and the increase was dose-dependently upregulated by icariin treatment. The phosphorylation of the p38 MAPK peaked on d 6 and decreased after d 8, and the activation was further enhanced and prolonged when the EB were subjected to icariin, which was concurrent with the elevation of PGC-1alpha, PPARalpha, and NRF-1. Moreover, the inhibition of the p38 MAPK pathway by SB203580 efficiently abolished icariin-stimulated cardiomyocyte differentiation and resulted in the capture of the upregulation of PGC-1alpha, PPARalpha, and NRF-1. CONCLUSION: Taken together, icariin promoted the expression of PGC-1alpha, PPARalpha, and NRF-1 during cardiomyocyte differentiation of murine ES cells in vitro and the effect was partly responsible for the activation of the p38 MAPK. [Abstract/Link to Full Text]

Wang T, Zhang ZX, Xu YJ, Hu QH
5-Hydroxydecanoate inhibits proliferation of hypoxic human pulmonary artery smooth muscle cells by blocking mitochondrial K(ATP) channels.
Acta Pharmacol Sin. 2007 Oct;28(10):1531-40.
AIM: To study the effect of 5-hydroxydecanoate (5-HD) on the proliferation of 24 h hypoxic human pulmonary artery smooth muscle cells (HPASMC) and to explore the pharmacological mechanisms of 5-HD as an inhibitor of mitochondrial membrane ATP-sensitive potassium channel activation. METHODS: Normoxic or hypoxic HPASMC in culture were stimulated by either diazoxide or 5-HD for 24 h. The proliferation of HPASMC was examined by 3- (4,5-dimethyl-2-thiazol-yl) -2,5-diphenyl- 2H-tetrazolium bromide (MTT) assay and proliferating cell nuclear antigen (PCNA) immunohistochemistry staining. The apoptosis of HPASMC was assessed by terminal deoxynucleotidyl transferase-mediated dUTP nick end labeling (TUNEL) assay and flow cytometric analysis. The relative changes in mitochondrial membrane potential (deltaPhi(m)) were measured using the rhodamine fluorescence (R-123) technique. RESULTS: Both hypoxia and diazoxide stimulation increased deltaPhi(m) value measured by the absorbance of MTT, PCNA-positive staining and decreased TUNEL-positive staining and apoptotic cells in HPASMC. Hypoxia and the concomitant stimulation of diazoxide obviously enhanced the effects of hypoxia or diazoxide alone. 5-HD significantly attenuated the effects in each of the above conditions. Additionally, 5-HD partially inhibited the effect of hypoxia on R-123 fluorescence intensity in HPASMC. CONCLUSION: 5-HD can inhibit the proliferation of hypoxic HPASMC by blocking mitochondrial K(ATP) channels. [Abstract/Link to Full Text]

Gu WL, Fu SL, Wang YX, Li Y, Wang XF, Xu XM, Lu PH
Expression and regulation of versican in neural precursor cells and their lineages.
Acta Pharmacol Sin. 2007 Oct;28(10):1519-30.
AIM: To have a better understanding of the expression and regulation of versican isoforms in neural precursor cells (NPC) and oligodendrogliogenesis. METHODS: By immunocytochemistry, RT-PCR, and real-time PCR, we examined the temporal expression of versican in NPC isolated from embryonic d 16 rats as well as in oligodendrocyte (OL) lineage cells induced to differentiate from NPC, which mimicked the oligodendrogliogenesis in vivo. RESULTS: We found that versican was constitutively expressed in NPC and their lineage cells, including neurons, astrocytes, and OL. In addition, 2 versican isoforms, V1/V0 and V2, were found to express at low levels in NPC, but at significantly higher levels in OL lineage cells. The peak expression of versican V2 was found at the oligodendrocyte precursor cell stage. Furthermore, the treatment of 2 pro-inflammatory cytokines, TNF-alpha and IFN-gamma, enhanced the transcription of versican V2 in NPC in a dose-dependent manner, but showed no effect on V1/V0 expression. CONCLUSION: Taken together, our results demonstrate that versican, particularly the inhibitory V2 isoform, is increasingly expressed in OL lineage cells induced to differentiate from NPC. An increase in versican V2 expression after cytokine stimulation implies the interplay between the injury-induced upregulation of inflammatory cytokines and chondroitin sulfate proteoglycan-mediated inhibition of axonal regeneration after central nervous system injury. [Abstract/Link to Full Text]

Michels II, Fang YX, Zhao D, Zhao LY, Lu L
Comparison of drug abuse in Germany and China.
Acta Pharmacol Sin. 2007 Oct;28(10):1505-18.
Drug abuse has a long, but also different history in Germany and China. The Opium War largely influenced the history of China in 19th century; however, China was once recognized as a drug-free nation for 3 decades from the 1950s to the 1980s. Drug abuse has spread quickly since re-emerging as a national problem in China in the late 1980s. The number of registered drug abusers increased from 70 000 in 1990 to more than 1 million by the end of 2005. In past decades, illicit drug trafficking and production have swept most provinces in China, and drug abuse has caused many problems for both abusers and the community. One major drug-related problem is the spread of HIV, which has caused major social and economic damage in China. Germany, the largest developed European country, also faces the drug and addiction problem. Germany has about 150 000 heroin addicts, for whom HIV/AIDS has become a serious threat since the mid 1980s. To control the drug problem, the German Government adopted the pAction Plan on Drugs and Addictionq in 2003; the China Central Government approved a similar regulation in the antidrug campaign in 2005. Germany has experience in reducing drug-related harm. The methadone maintenance treatment (MMT) program has run for more than 20 years and the public has become more tolerant of addicts. In 2003, China began the MMT program for controlling the spread of HIV/AIDS. It is necessary for China to learn from developed countries to acquire success in its antidrug campaign. In this review, we will go over the differences and similarities in drug abuse between Germany and China. The differences are related to history, population and economics, drug policy context, drug laws, HIV/hepatitis C virus infection, the MMT program and so on. These 2 nations have drug abuse problems with different histories and currently use different approaches to handle illicit drug marketing and use. The legal penalties for illicit drug offences reflect the social differences of these 2 nations with respect to the seriousness of particular types of crimes. The characteristics of the MMT program may also influence patterns of drug abuse in these 2 nations and China should improve the MMT program based on the successful model in Europe, the USA, and Australia. We recommend more dialogue and collaboration between Germany and China. [Abstract/Link to Full Text]

Shi Y, He B, You L, Jablons DM
Roles of secreted frizzled-related proteins in cancer.
Acta Pharmacol Sin. 2007 Sep;28(9):1499-504.
The Wnt signaling pathway is implicated in a variety of biological processes ranging from developmental cell fate to human disease. The components involved in Wnt signaling have been under intense investigation over the last 2 decades. Aberrant canonical Wnt activation has been linked to tumor formation and involves activation of effector molecules or loss of tumor suppressor function. Secreted frizzled-related proteins (sFRPs) are Wnt antagonists. In recent years, accumulating evidence has suggested that sFRPs act as tumor suppressors because their expression is frequently silenced in cancer by promoter hypermethylation. However, sFRPs may also promote cell growth in some contexts. Here, we focus on the known knowledge of sFRPs in tumorigenesis. [Abstract/Link to Full Text]

Ding J, Feng Y, Wang HY
From cell signaling to cancer therapy.
Acta Pharmacol Sin. 2007 Sep;28(9):1494-8.
Cancer has been seriously threatening the health and life of humans for a long period. Despite the intensive effort put into revealing the underlying mechanisms of cancer, the detailled machinery of carcinogenesis is still far from fully understood. Numerous studies have illustrated that cell signaling is extensively involved in tumor initiation, promotion and progression. Therefore, targeting the key molecules in the oncogenic signaling pathway might be one of the most promising ways to conquer cancer. Some targeted drugs, such as imatinib mesylate (Gleevec), herceptin, gefitinib (Iressa), sorafenib (Nexavar) and sunitinib (Sutent), which evolve from monotarget drug into multitarget ones, have been developed with encouraging effects. [Abstract/Link to Full Text]

Zhu Z
Targeted cancer therapies based on antibodies directed against epidermal growth factor receptor: status and perspectives.
Acta Pharmacol Sin. 2007 Sep;28(9):1476-93.
Compelling experimental and clinical evidence suggests that epidermal growth factor receptor (EGFR) plays an important role in the pathogenesis of a variety of human cancers; thus, providing a strong rationale for the development of receptor antagonists as effective and specific therapeutic strategies for the treatment of EGFR-expressing cancers. Monoclonal antibodies (mAb), owing to their high specificity towards a given target, represent a unique class of novel cancer therapeutics. A number of anti-EGFR mAb are currently being developed in our clinic, including two that have been approved by the United States Food and Drug Administration for the treatment of refractory metastatic colorectal cancer (mCRC) and squamous cell carcinomas of the head and neck (SCCHN). Cetuximab (Erbitux, IMC-C225), an IgG1 mAb, has demonstrated significant antitumor activity, both as a single agent and in combination with chemotherapeutics and radiation, in patients with refractory mCRC and SCCHN, respectively. Panitumumab (Vectibix), an IgG2 mAb, has been approved as a single agent for the treatment of patients with refractory mCRC. These mAb, via blocking ligand/receptor interactions, exert their biological activity via multiple mechanisms, including inhibition of cell cycle progression, potentiation of cell apoptosis, inhibition of DNA repair, inhibition of angiogenesis, tumor cell invasion and metastasis and, potentially, induction of immunological effector mechanisms. Anti-EGFR antibodies have demonstrated good safety profiles and potent anticancer activity in our clinic and may prove to be efficacious agents in the treatment of a variety of human malignancies. [Abstract/Link to Full Text]

Raina K, Agarwal R
Combinatorial strategies for cancer eradication by silibinin and cytotoxic agents: efficacy and mechanisms.
Acta Pharmacol Sin. 2007 Sep;28(9):1466-75.
In an effort to develop effective alternative strategies that increase the therapeutic efficacy and minimize the systemic toxicity of chemotherapeutic agents, more efforts are being directed towards the investigation of dietary supplements and other phytotherapeutic agents for their synergistic efficacy in combination with anticancer drugs. One such agent is silibinin, which has shown promising chemopreventive and anticancer effects in various in vitro and in vivo studies. The present review summarizes the effects of the combination of silibinin and chemotherapeutic drugs on the growth inhibition, cell cycle regulation, and apoptosis induction in prostate, breast, and lung cancer systems. Together, the results indicate a synergistic effect of silibinin on growth inhibition, reversal of chemoresistance, apoptosis induction, and a strong increase in G2-M checkpoint arrest when given in combination with these drugs. These results are highly significant with respect to the combined chemotherapy approach, wherein the criteria for combination is that the response has to be synergistic and that the drugs should not share common mechanisms of resistance and not overlap in their major side-effects. [Abstract/Link to Full Text]

Meng LH, Ding J
Salvicine, a novel topoisomerase II inhibitor, exerts its potent anticancer activity by ROS generation.
Acta Pharmacol Sin. 2007 Sep;28(9):1460-5.
Salvicine is a novel diterpenoid quinone compound obtained by structural modification of a natural product lead isolated from a Chinese herb with potent growth inhibitory activity against a wide spectrum of human tumor cells in vitro and in mice bearing human tumor xenografts. Salvicine has also been found to have a profound cytotoxic effect on multidrug-resisitant (MDR) cells. Moreover, Salvicine significantly reduced the lung metastatic foci of MDA-MB-435 orthotopic xenograft. Recent studies demonstrated that salvicine is a novel non-intercalative topoisomerase II (Topo II) poison by binding to the ATPase domain, promoting DNA-Topo II binding and inhibiting Topo II-mediated DNA relegation and ATP hydrolysis. Further studies have indicated that salcivine-elicited ROS plays a central role in salvicine-induced cellular response including Topo II inhibition, DNA damage, circumventing MDR and tumor cell adhesion inhibition. [Abstract/Link to Full Text]

Clapper ML, Cooper HS, Chang WC
Dextran sulfate sodium-induced colitis-associated neoplasia: a promising model for the development of chemopreventive interventions.
Acta Pharmacol Sin. 2007 Sep;28(9):1450-9.
Individuals diagnosed with ulcerative colitis face a significantly increased risk of developing colorectal dysplasia and cancer during their lifetime. To date, little attention has been given to the development of a chemopreventive intervention for this high-risk population. The mouse model of dextran sulfate sodium (DSS) - induced colitis represents an excellent preclinical system in which to both characterize the molecular events required for tumor formation in the presence of inflammation and assess the ability of select agents to inhibit this process. Cyclic administration of DSS in drinking water results in the establishment of chronic colitis and the development of colorectal dysplasias and cancers with pathological features that resemble those of human colitis-associated neoplasia. The incidence and multiplicity of lesions observed varies depending on the mouse strain used (ie, Swiss Webster, C57BL/6J, CBA, ICR) and the dose (0.7%-5.0%) and schedule (1-15 cycles with or without a subsequent recovery period) of DSS. The incidence of neoplasia can be increased and its progression to invasive cancer accelerated significantly by administering DSS in combination with a known colon carcinogen (azoxymethane (AOM), 2-amino-3-methylimidazo[4,5-f]quinoline (IQ), 2-amino-1- methyl-6-phenylimidazo[4,5-b]pyridine (PhIP)) or iron. More recent induction of colitis-associated neoplasia in genetically defined mouse strains has provided new insight into the role of specific genes (ie, adenomatous polyposis coli (Apc), p53, inducible nitric oxide synthase (iNOS), Msh2) in the development of colitis-associated neoplasias. Emerging data from chemopreventive intervention studies document the efficacy of several agents in inhibiting DSS-induced neoplasia and provide great promise that colitis-associated colorectal neoplasia is a preventable disease. [Abstract/Link to Full Text]

Zhou GB, Li G, Chen SJ, Chen Z
From dissection of disease pathogenesis to elucidation of mechanisms of targeted therapies: leukemia research in the genomic era.
Acta Pharmacol Sin. 2007 Sep;28(9):1434-49.
Leukemia is a group of heterozygous diseases of hematopoietic stem/progenitor cells that involves dynamic change in the genome. Dissection of genetic abnormalities critical to leukemia initiation provides insights into the elusive leukemogenesis, identifies distinct subsets of leukemia and predicts prognosis individually, and can also provide rational therapeutic targets for curative approaches. The past three decades have seen tremendous advances in the analysis of genotype-phenotype connection of leukemia, and in the identification of molecular biomarkers for leukemia subtypes. Intriguingly, differentiation therapy, targeted therapy and chemotherapy have turned several subtypes of leukemia from highly fatal to highly curable. The use of all-trans retinoic acid and arsenic trioxide, which trigger degradation of PML-RARalpha, the causative fusion protein generated by t (15;17) translocation in acute promyelocytic leukemia (APL), has led to a dramatic improvement of APL clinical outcome. Imatinib mesylate/ Gleevec/STI571, which inhibits the tyrosine kinase activity of BCR-ABL oncoprotein, has now become the new gold standard for the treatment of chronic myeloid leukemia. Optimal use of chemotherapeutic agents together with a stringent application of prognostic factors for risk-directed therapy in clinical trials has resulted in a steady improvement in the treatment outcome of acute lymphoblastic leukemia. Hence, the pace of progress extrapolates to a prediction of leukemia control in the twenty-first century. [Abstract/Link to Full Text]

Kozoni V, Rosenberg T, Rigas B
Development of novel agents based on nitric oxide for the control of colon cancer.
Acta Pharmacol Sin. 2007 Sep;28(9):1429-33.
Nitric oxide-donating nonsteroidal anti-inflammatory drugs (NO-NSAIDs) represent a novel class of compounds that hold promise as agents for the control of colon cancer. They are derivatives of conventional NSAIDs that have been modified by adding to them, via a spacer molecule, a nitric oxide releasing moiety. The expectation is that the combined effects of NO and the NSAID moiety will exceed those of each structural component alone. Extensive work has demonstrated their potency and efficacy in preclinical models of colon cancer. The mechanism of action of NO-NSAIDs involves the modulation of several critical cellular signaling pathways, whereas the induction of a state of oxidative stress, at least by NO-aspirin, appears to be a major proximal event. Clinical trials are needed to assess the role of NO-NSAIDs in the control of colon cancer. [Abstract/Link to Full Text]

Stoner GD, Aziz RM
Prevention and therapy of squamous cell carcinoma of the rodent esophagus using freeze-dried black raspberries.
Acta Pharmacol Sin. 2007 Sep;28(9):1422-8.
AIM: This study was conducted to determine if short-term treatment of Nnitrosomethylbenzylamine (NMBA)-induced tumors in the rat esophagus with dietary freeze-dried black raspberries (FBR) would result in tumor regression and enhanced survival of the animals. METHODS: Four-week-old male Fisher-344 rats were administered an AIN-76A control diet and injected subcutaneously with 0.5 mg/kg NMBA once per week for 15 weeks. At 19 weeks, when rats had an average of 5-6 tumors (papillomas) per esophagus, they were given a control diet containing either 5%, 10%, or 20% FBR. After 7 weeks of berry treatment, all surviving rats were killed and tumor incidence, number and volume were determined. RESULTS: Esophageal tumor incidences, numbers and volumes in NMBA-treated rats were not influenced by any of the berry treatments. There were progressive increases in the survival of NMBA-treated rats fed 5%-20% FBR diets; however, these increases were not significant. CONCLUSION: FBR at 5%, 10%, and 20% of the diet had no effect on the development of NMBA-induced tumors in the rat esophagus or on animal survival when administered for 7 weeks beginning at the papilloma stage of tumor development. Thus, FBR appear to have no therapeutic value in the treatment of esophageal tumors. In contrast, dietary FBR are highly effective in preventing the development of NMBA-induced esophageal tumors in rats when administered before and during NMBA treatment or shortly after NMBA treatment when the esophagi contain preneoplastic (dysplastic) lesions of varying degrees of severity. [Abstract/Link to Full Text]

Kwon KH, Barve A, Yu S, Huang MT, Kong AN
Cancer chemoprevention by phytochemicals: potential molecular targets, biomarkers and animal models.
Acta Pharmacol Sin. 2007 Sep;28(9):1409-21.
Recent studies have strongly indicated that certain daily-consumed dietary phytochemicals could have cancer protective effects against transgenic mice cancer models and cancers mediated by carcinogens, irradiations and carcinogenic metabolites derived from exogenous or endogenous sources. The cancer-protective effects elicited by these dietary compounds are believed to be due at least in part to the induction of cellular defense systems including the detoxifying and antioxidant enzymes system, as well as the inhibition of anti-inflammatory and anti-cell growth signaling pathways culminating in cell cycle arrest and/or celldeath. In this review, we summarize the potential mechanisms including the modulation of nuclear factor kappaB (NF-kappaB), cyclooxygenases-2 (COX-2), activator protein-1 (AP-1), mitogen-activated protein kinases (MAPKs) and the induction of phase II cellular detoxifying and antioxidant enzymes mediated mainly by the antioxidant response elements (ARE) within the promoter regions of these genes through nuclear factor-erythroid 2-related factor 2 (Nrf2), a member of the Cap "n" collar (CNC) family of the basic region-leucine zipper transcription factor. In addition, we also review several animal models of carcinogenesis and cancer chemopreventive efficacy studies of these animal models using dietary chemopreventive compounds. Finally, we discuss the cellular signaling cascades mediated by Nrf2, NF-kappaB, AP-1, MAPKs and COX-2, which have been considered to play pivotal roles in tumor initiation, promotion and progression processes, and could be promising molecular targets for the design of drugs targeting cancer prevention and therapy. [Abstract/Link to Full Text]

Siddiqui IA, Saleem M, Adhami VM, Asim M, Mukhtar H
Tea beverage in chemoprevention and chemotherapy of prostate cancer.
Acta Pharmacol Sin. 2007 Sep;28(9):1392-408.
Prostate cancer (PCa) is the most frequently diagnosed malignancy and the second leading cause of cancer-related deaths in American males with similar trends in many western countries. The existing treatment approaches and surgical intervention have not been able to effectively cope with this dreaded disease. For these reasons, it is necessary to intensify our efforts for a better understanding of the disease process and for the development of novel approaches for its prevention and treatment. Based on considerable evidence from in vivo and in vitro data and epidemiological studies, in recent years the beverage tea has gained considerable attention for reducing the risk of several cancers. Much of the cancer preventive effects of tea, especially green tea appear to be mediated by the polyphenols present therein. Geographical evidence suggests that the incidence and occurrence of PCa is lower in populations that consume tea regularly. This evidence suggests that tea polyphenols could be extrapolated to optimize their chemopreventive properties against PCa. PCa represents an excellent candidate disease for chemoprevention because it is typically diagnosed in men over 50 years of age and therefore, even a modest delay in neoplastic development achieved through pharmacological or nutritional intervention could result in a substantial reduction in the incidence of clinically detectable disease. In this review we address the issue of possible use of tea, especially green tea, for the prevention as well as treatment of PCa. [Abstract/Link to Full Text]

Niles RM
Biomarker and animal models for assessment of retinoid efficacy in cancer chemoprevention.
Acta Pharmacol Sin. 2007 Sep;28(9):1383-91.
Vitamin A is essential for normal growth and development. Epidemiology and laboratory studies suggest that decreased vitamin A levels and defective metabolism/ action may contribute to the genesis of certain cancers. Based on this information, natural and synthetic derivatives of vitamin A (retinoids) have been used for chemoprevention of cancer. Retinoids have had some success in the chemoprevention of leukoplakia and in the decreased incidence of second primaries in head and neck cancer. There is little information on biomarkers that can be used to assess the efficacy of the chemopreventive activity of retinoids. The ability of retinoids to induce RARb has been consistently shown to correlate with the response of cells and tissues to retinoic acid, but few other biomarkers have been certified as indicators of retinoid activity. In light of the failure of the ATBC and CARET clinical intervention trials for chemoprevention of lung cancer, greater use of animal models for chemoprevention studies is necessary. The potential combination of phytochemicals that inhibit DNA methyltransferase activity with retinoids holds promise for more effective chemoprevention of retinoid-unresponsive premalignant lesions. [Abstract/Link to Full Text]

Welsh J
Vitamin D and prevention of breast cancer.
Acta Pharmacol Sin. 2007 Sep;28(9):1373-82.
Epidemiologic data have demonstrated that breast cancer incidence is inversely correlated with indices of vitamin D status, including ultraviolet exposure, which enhances epidermal vitamin D synthesis. The vitamin D receptor (VDR) is expressed in mammary epithelial cells, suggesting that vitamin D may directly influence sensitivity of the gland to transformation. Consistent with this concept, in vitro studies have demonstrated that the VDR ligand, 1,25-dihydroxyvitamin D (1, 25D), exerts negative growth regulatory effects on mammary epithelial cells that contribute to maintenance of the differentiated phenotype. Furthermore, deletion of the VDR gene in mice alters the balance between proliferation and apoptosis in the mammary gland, which ultimately enhances its susceptibility to carcinogenesis. In addition, dietary supplementation with vitamin D, or chronic treatment with synthetic VDR agonists, reduces the incidence of carcinogen-induced mammary tumors in rodents. Collectively, these observations have reinforced the need to further define the human requirement for vitamin D and the molecular actions of the VDR in relation to prevention of breast cancer. [Abstract/Link to Full Text]

Lu J, Kim SH, Jiang C, Lee H, Guo J
Oriental herbs as a source of novel anti-androgen and prostate cancer chemopreventive agents.
Acta Pharmacol Sin. 2007 Sep;28(9):1365-72.
Androgen and androgen receptor (AR) signaling are crucial for the genesis of prostate cancer (PCa), which can often develop into androgen-ligand-independent diseases that are lethal to the patients. Recent studies show that even these hormone-refractory PCa require ligand-independent AR signaling for survival. As current chemotherapy is largely ineffective for PCa and has serious toxic sideeffects, we have initiated a collaborative effort to identify and develop novel, safe and naturally occurring agents that target AR signaling from Oriental medicinal herbs for the chemoprevention and treatment of PCa. We highlight our discovery of decursin from an Oriental formula containing Korean Angelica gigas Nakai (Dang Gui) root as a novel anti-androgen/AR agent. We have identified the following mechanisms to account for the specific anti-AR actions: rapid block of AR nuclear translocation, inhibition of binding of 5alpha-dihydrotestesterone to AR and increased proteasomal degradation of AR protein. Furthermore, decursin lacks the agonist activity of the "pure" anti-androgen bicalutamide and is more potent than bicalutamide in inducing PCa apoptosis. Structure-activity analyses reveal a critical requirement of the side-chain on decursin or its structural isomer decursinol angelate for anti-AR, cell cycle arrest and proapoptotic activities. This work demonstrates the feasibility of using activity-guided fractionation in cell culture assays combined with mechanistic studies to identify novel anti-androgen/ AR agents from complex herbal mixtures. [Abstract/Link to Full Text]

Herman-Antosiewicz A, Powolny AA, Singh SV
Molecular targets of cancer chemoprevention by garlic-derived organosulfides.
Acta Pharmacol Sin. 2007 Sep;28(9):1355-64.
The medicinal benefits of Allium vegetables, especially garlic, have been noted throughout recorded history. The known health benefits of Allium vegetables and their constituents include cardiovascular protective effects, stimulation of immune function, reduction of blood glucose level, radioprotection, improvement of memory loss, protection against microbial, viral and fungal infections, as well as anticancer effects. Population-based case control studies have suggested an inverse correlation between dietary intake of Allium vegetables and the risk of different types of cancers. The anticarcinogenic effect of Allium vegetables including garlic is attributed to organosulfur compounds (OSC), which are highly effective in affording protection against cancer in animal models induced by a variety of chemical carcinogens. More recent studies have shown that certain naturally occurring OSC analogues can suppress proliferation of cancer cells in culture and in vivo. The OSC-induced changes in the proliferation of cancer cells are frequently associated with perturbations in cell cycle progression and induction of G2/M phase arrest. The OSC have also been demonstrated to induce apoptosis via the intrinsic pathway by altering the ratio of the Bcl-2 family of proteins both in cell culture and in in vivo models. Anti-angiogenic activity for garlic-derived OSC has also been documented. This article summarizes current knowledge on molecular targets of cancer chemoprevention by OSC. [Abstract/Link to Full Text]

Zhang Y, Tang L
Discovery and development of sulforaphane as a cancer chemopreventive phytochemical.
Acta Pharmacol Sin. 2007 Sep;28(9):1343-54.
Sulforaphane (SF) is a phytochemical that displays both anticarcinogenic and anticancer activity. SF modulates many cancer-related events, including susceptibility to carcinogens, cell death, cell cycle, angiogenesis, invasion and metastasis. We review its discovery and development as a cancer chemopreventive agent with the intention of encouraging further research on this important compound and facilitating the identification and development of new phytochemicals for cancer prevention. [Abstract/Link to Full Text]

Yates MS, Kensler TW
Keap1 eye on the target: chemoprevention of liver cancer.
Acta Pharmacol Sin. 2007 Sep;28(9):1331-42.
Hepatocellular carcinoma (HCC) is one of the most common cancers worldwide, causing nearly 600,000 deaths each year. Increased risk of HCC due to chronic infection with hepatitis B virus (HBV) and exposure to dietary aflatoxins is responsible for many of these deaths. Prevention strategies targeting HBV infection and aflatoxin exposure could dramatically impact the rates of HCC. Universal HBV vaccination programs have begun in some high-risk areas. Strategies to reduce aflatoxin contamination in food stores have also been implemented. However, complete elimination of aflatoxin contamination might not be possible. For this reason, chemoprevention strategies which alter aflatoxin disposition are a practical strategy to reduce the incidence of HCC in populations with high dietary aflatoxin exposure. The mechanisms of aflatoxin-induced hepatocarcinogenesis are well known. This knowledge provides the basis for evaluation of both exposures to aflatoxin, as well as modulation of aflatoxin disposition by chemopreventive agents. Products of aflatoxin DNA damage and toxicity as well as other metabolites can be used as biomarkers to evaluate modulation of aflatoxin disposition. Modulation of aflatoxin disposition can be achieved through induction of conjugating and cytoprotective enzymes. Many of these enzymes are regulated through Kelch ECH-associating protein 1 (Keap1)-NF-E2-related factor 2(Nrf2)-antioxidant response element (ARE) signaling, making this pathway an important molecular target for chemoprevention. Rodent studies have identified several classes of chemopreventive agents which induce cytoprotective genes. These inducers include phenolic antioxidants, dithiolethiones, isothiocyanates, and triterpenoids. Furthermore, clinical interventions have shown that inducers of Keap1-Nrf2- ARE signaling increase cytoprotective enzyme expression, resulting in modulation of aflatoxin disposition. Much work remains to be done in order to take promising chemopreventive agents from preclinical evaluation to application in at-risk populations. However, appropriately designed clinical trials will aid in this process, which can have profound impact on the incidence of HCC. [Abstract/Link to Full Text]

Yang JM
Emerging roles of deubiquitinating enzymes in human cancer.
Acta Pharmacol Sin. 2007 Sep;28(9):1325-30.
Protein modifications by the covalent linkage of ubiquitin have significant involvement in many cellular processes, including stress response, oncogenesis, viral infection, transcription, protein turnover, organelle biogenesis, DNA repair, cellular differentiation, and cell cycle control. Protein ubiquitination and subsequent degradation by the proteasome require the participation of both ubiquitinating enzymes and deubiquitinating enzymes. Although deubiquitinating enzymes constitute a large family in the ubiquitin system, the study of this class of proteins is still in its infant stage. Recent studies have revealed a variety of molecular and biological functions of deubiquitinating enzymes and their association with human diseases. In this review we will discuss the possible roles that deubiquitinating enzymes may play in cancers. [Abstract/Link to Full Text]

Recent Articles in Biological & Pharmaceutical Bulletin

Fang S, Wu Z, Zhang X, Liu Y, Wang W, Chai L, Cai H, Yi J, Wang L, Chen Y, Lv X, Huang Y, Wang R, Chen P
Clinical observation on YiSuiShengXueGranule on treating 156 patients with beta-thalassemia major and the molecular mechanism study.
Biol Pharm Bull. 2007 Nov;30(11):2084-7.
OBJECTIVE: To investigate the clinical effects and security of YiSuiShengXueGranule (YSSXG) on treating 156 patients with beta-thalassemia major. Methods: YSSXG was given orally to 156 patients with beta-thalassemia in GuangXi Autonomous Region (the high incidence area of beta-thalassemia in China) for 3 months as one therapeutic course, 3 times a day, 10 g each time (for children, the dose should be reduced properly according to their body weight and age), and no blood transfusion used during the course. Clinical symptoms and levels of hemoglobin (Hb), red blood cell (RBC), reticulocyte (Ret) and hemoglobin F (HbF) were observed before and after treatment, and side-effects were observed during the course. A 3-6 months follow up study was performed after withdrawal of YSSXG. And systemic gene analysis was conducted with PCR, SSCP-PCR, RT-PCR and DNA sequences analysis and mRNA differently expression technique, in order to study the molecular mechanism from the relationships between genetic mutation and clinical efficacy, gene expression and its regulation. RESULTS: Levels of Hb, RBC, Ret and HbF obviously elevated, and clinical symptoms markedly ameliorated in patients after treated with YSSXG from the 1st to 3rd month (all p<0.01). Dynamical observation showed that the improvement of symptoms kept accordance with the elevation of hemorrheological indexes. The treatment was effective in 145 patients and ineffective in 11, and the total effective rate was 92.9%, without any adverse reaction founded. Follow-up studies showed the therapeutic effect could sustain for 3 to 4 months after drug-withdrawal. The molecular mechanism study showed: YSSXG did not change the genetic mutation type, but could obviously increase gamma/(beta+gamma) globin ratio, both gamma-globin mRNA and GM-CSF mRNA expression were significantly enhanced so as to induce HbF synthesis increasing after treated with YSSXG. CONCLUSION: YSSXG had obvious effects in treating beta-thalassemia by unlocking gamma-gene, increasing the gamma-globin expression and enhancing HbF synthesis so as to compensate for the gene defect. This study has provided a new path for the treatment of beta-thalassemia with Traditional Chinese Medicine. [Abstract/Link to Full Text]

Ma W, Nomura M, Takahashi-Nishioka T, Kobayashi S
Combined effects of fangchinoline from Stephania tetrandra Radix and formononetin and calycosin from Astragalus membranaceus Radix on hyperglycemia and hypoinsulinemia in streptozotocin-diabetic mice.
Biol Pharm Bull. 2007 Nov;30(11):2079-83.
The anti-hyperglycemic action of Stephania tetrandra Radix (Stephania) is potentiated by Astragalus membranaceus BUNGE Radix (Astragali) in streptozotocin (STZ)-diabetic ddY mice (Tsutsumi et al., Biol. Pharm. Bull., 26, 313 (2003)). Fangchinoline (0.3-3 mg/kg), a main constituent of Stephania, decreased the high level of blood glucose and increased the low level of blood insulin in STZ-diabetic mice. Here, we investigated the combined effects of fangchinoline with isoflavone or isoflavonoid components (formononetin, calycosin and ononin) of Astragali on the hyperglycemia and hypoinsulinemia of STZ-diabetic mice. Formononetin, calycosin and ononin (0.03-0.1 mg/kg) alone did not affect the blood glucose or blood insulin level of the diabetic mice. Formononetin and calycosin (0.03-0.1 mg/kg) potentiated the anti-hyperglycemic action of fangchinoline (0.3 mg/kg), but ononin did not. Formononetin (0.1 mg/kg) facilitated the fangchinoline-induced insulin release, and calycosin (0.1 mg/kg) also facilitated it, though without statistical significance. In conclusion, the combined effect of fangchinoline with formononetin and calycosin on hyperglycemia in the diabetic mice accounted well for the therapeutic effect of the combination of Stephania with Astragali in Boi-ogi-to. The anti-hyperglycemic action of formononetin appeared to be due to its potentiating action on insulin release. Our strategy for studying combinations of crude drugs and their components in Kampo medicine has uncovered new potentiating effects of formononetin and calycosin on the anti-hyperglycemic action of fangchinoline in STZ-diabetic mice. [Abstract/Link to Full Text]

Liu J, Sun H, Duan W, Mu D, Zhang L
Maslinic acid reduces blood glucose in KK-Ay mice.
Biol Pharm Bull. 2007 Nov;30(11):2075-8.
In the present study, we have examined the hypoglycemic effect of maslinic acid (MA) in KK-A(y) mice, an animal model of genetic type-2 diabetes. MA (10 mg/kg body wt) reduced the blood glucose levels in KK-A(y) mice at 4 h after a single oral dose. KK-A(y) mice receiving MA at daily dosages of 10 mg/kg and 30 mg/kg for 2 weeks showed a significant reduction in the blood glucose levels. Furthermore, the results also showed that MA might modulate glucose metabolism partially through reducing insulin resistance in KK-A(y) mice. Taken together, MA may hold great promise as a natural therapeutic agent for treatment of type 2 diabetes. [Abstract/Link to Full Text]

Kanno S, Hiura T, Shouji A, Osanai Y, Ujibe M, Ishikawa M
Resistance to Ara-C up-regulates the activation of NF-kappaB, telomerase activity and Fas expression in NALM-6 cells.
Biol Pharm Bull. 2007 Nov;30(11):2069-74.
Cytosine arabinoside (1-beta-D-arabinofuranosylcytosine; Ara-C) is the most important antimetabolite used to induce remission in acute leukemia, but cellular resistance to Ara-C reflects a poor prognosis in cancer chemotherapy. To further investigate the mechanisms of resistance to Ara-C, we have established Ara-C-resistant NALM-6 cells. The activation of nuclear factor kappaB (NF-kappaB) was accompanied by the acquisition of Ara-C resistance. Telomerase activity has also increased with the acquisition of Ara-C resistance. The expression of Bid, Bax, or p53 proteins have been shown to increase correlated with the acquisition of Ara-C resistance. In contrast to the increase in these proteins, Bcl-2, Bcl-x, and Bag-1 proteins remained unchanged with the acquisition of Ara-C resistance. Fas expression increased with the acquisition of Ara-C resistance in the late stage. The induction of apoptosis and reduction of cell viability by cytotoxic anti-Fas antibody was more susceptible in resistant cells than parental cells. In conclusion, this report has shown that resistance to Ara-C up-regulates the activation of NF-kappaB, telomerase activity and Fas expression. [Abstract/Link to Full Text]

Tsukiyama M, Akaishi T, Ueki T, Okumura H, Abe K
The extract from Nandina domestica THUNBERG inhibits histamine- and serotonin-induced contraction in isolated guinea pig trachea.
Biol Pharm Bull. 2007 Nov;30(11):2063-8.
Although the fruit of Nandina domestica THUNBERG (ND) has been used to treat respiratory disorders such as coughing and breathing difficulty in Japan for many years, very little is known about mechanisms underlying its action. In the present study, we investigated effects of the crude extract from ND (NDE) and one of its constituents, nantenine, on contractile responses in isolated guinea pig tracheal ring preparations. In normal experimental condition, guinea pig trachea remained tonically contracted during the resting state, and addition of NDE (1 mg/ml) caused a relaxation of tracheal smooth muscles, but had little effect on the responsiveness of trachea to acetylcholine. The basal, tonic contraction was abolished by the presence of atropine and indomethacin. In this condition, NDE at 0.1-1 mg/ml inhibited histamine-induced contraction in both competitive and non-competitive manners. NDE at 0.01-1 mg/ml inhibited serotonin-induced contraction in a competitive manner. Nantenine (2-20 microM) did not affect histamine-induced contraction, and slightly inhibited serotonin-induced contraction. These results suggest that NDE has inhibitory effects on tracheal smooth muscle contraction, and nantenine cannot account solely for this effect of NDE. [Abstract/Link to Full Text]

Xu JD, Wang W, Li LS, Chen X, Zhu JX
Involvement of endogenous prostaglandin in emodin-evoked rat colonic anion secretion.
Biol Pharm Bull. 2007 Nov;30(11):2058-62.
It has been reported that emodin is able to promote gastrointestinal motility and stimulate large intestinal water secretion; however, the mechanism is still not clear. The aim of the present study is to examine the effects of emodin on the rat colonic transepithelial ion transport and the underlying mechanism. The study was carried out by means of the short circuit current (I(SC)) recording. Basolateral application of emodin induced a concentration-dependent I(SC) increase, and the EC(50) was 76.0 micromol/l. Pretreatment with epithelial Na(+) channel blocker, amiloride (10 micromol/l), did not affect the I(SC) responses elicited by emodin, but removal of extracellular Cl(-) or apical pretreatment with Cl(-) channel blocker, glibenclamide (1 mmol/l) inhibited emodin-elicited I(SC) responses by 76.3% and 83.8% respectively. Inhibiting basolateral Na(+)-K(+)-2Cl(-) cotransporter (NKCC) with bumetanide (100 micromol/l) decreased emodin-induced I(SC) from 118.1+/-6.7 microA/cm(2) to 16.7+/-2.0 microA/cm(2), which was reduced by 85.9%. Basolateral pretreatment with neuronal Na(+) channel blocker tetrodotoxin (TTX) (1 micromol/l) did not affect emodin-induced I(SC) increase, but pretreatment with indomethacin (10 micromol/l) alone or with both TTX and indomethacin significantly decreased emodin-induced I(SC) increase by 88.4 and 81.2%, respectively. The present study demonstrated that emodin was able to stimulate rat colonic epithelial Cl(-) secretion, which was predominantly mediated by endogenous prostaglandin release. [Abstract/Link to Full Text]

Kaneko T, Tahara S, Takabayashi F
Inhibitory effect of natural coumarin compounds, esculetin and esculin, on oxidative DNA damage and formation of aberrant crypt foci and tumors induced by 1,2-dimethylhydrazine in rat colons.
Biol Pharm Bull. 2007 Nov;30(11):2052-7.
The effects of esculetin (6,7-dihydroxycoumarin) and its 6-glycoside, esculin, on 8-oxo-2'-deoxyguanosine (8-oxodG) formation and carcinogenesis induced by a chemical carcinogen, 1,2-dimethylhydrazine (DMH), were examined in the colons of male Fischer 344 rats. Animals were given water containing esculetin or esculin for 7 d before subcutaneous injection of DMH (20 mg/kg body wt), killed 24 h after DMH treatment, and the levels of thiobarbituric acid reactive substances (TBARS) and 8-oxodG in the colons were determined. Both esculetin and esculin suppressed significantly the DMH-induced increases in 8-oxodG and TBARS in rat colon mucosa. We further investigated the modifying effect of esculin intake on the development of DMH-induced colonic aberrant crypt foci (ACF). Animals were given DMH once a week for 4 weeks to induce ACF. They then received water containing esculin ad libitum for 5 weeks (initiation phase) or 11 weeks after DMH treatment (post-initiation phase). Animals in the positive control group received tap water throughout the experiment. At the end of the experiment (16 weeks), the ingestion of esculin during the initiation phase significantly reduced the incidence of gross tumors, the number of ACF per rat and the mean number of AC per focus, while the esculin treatment during the post-initiation phase significantly decreased only the number of ACF per rat. These results suggest that esculin intake has an inhibitory effect on DMH-induced oxidative DNA damage and carcinogenesis in rat colons. [Abstract/Link to Full Text]

Lee JY, Kim JY, Lee YG, Byeon SE, Kim BH, Rhee MH, Lee A, Kwon M, Hong S, Cho JY
In vitro immunoregulatory effects of Korean mistletoe lectin on functional activation of monocytic and macrophage-like cells.
Biol Pharm Bull. 2007 Nov;30(11):2043-51.
Korean mistletoe lectin (KML) is one of the major active components in Viscum album var. (coloratum), displaying various biological effects such as anti-tumor and anti-metastatic activities. Even though it has been shown to boost host immune defense mechanisms, the immunomodulatory effects of KML on specific immune responses mediated by macrophages have not been fully elucidated. Therefore, in this study, we aimed to demonstrate KML's regulatory roles on macrophage-mediated immune responses. KML clearly blocked lipopolysaccharide (LPS)-induced events [expression of interleukin (IL)-10, nitric oxide (NO) production and phagocytic uptake], and suppressed the normal expression levels of IL-10 (at 2 ng/ml) and tumor necrosis factor (TNF)-alpha (at 10 ng/ml). In contrast, (1) the expression of cytokine (TNF-alpha) and (2) the generation of reactive oxygen species (ROS) induced by LPS were significantly up-regulated with KML co-treatment. In addition, KML itself increased the mRNA levels of IL-3 and IL-23; phagocytic uptake; the surface levels of co-stimulatory molecules (CD80 and CD86), pattern recognition receptors (PRRs) [such as dectin-1 and toll like receptor (TLR)-2] and adhesion molecules [beta1-integrins (CD29) and CD43]; and CD29-mediated cell adhesion events. Finally, according to co-treatment of D-galactose with KML under LPS-induced NO production conditions, KML inhibition seems to be mediated by binding to proteins with D-galactose. Therefore, these data suggest that KML may participate in regulating various macrophage-mediated innate and adaptive responses via binding to surface protein with D-galactose and that some of these may deserve in KML's therapeutic activities such as anti-tumor and anti-microbial effects. [Abstract/Link to Full Text]

Kim HS, Parajuli SP, Yeum CH, Park JS, Jeong HS, So I, Kim KW, Jun JY, Choi S
Effects of ginseng total saponins on pacemaker currents of interstitial cells of cajal from the small intestine of mice.
Biol Pharm Bull. 2007 Nov;30(11):2037-42.
Although ginsenosides have a variety of physiologic or pharmacologic functions in various regions, there are only a few reports on the effects of ginsenosides on gastrointestinal (GI) motility. We studied the modulation of pacemaker activities by ginseng total saponins in the interstitial cells of Cajal (ICC) using the whole cell patch-clamp technique. Externally applied ginseng total saponins (GTS) produced membrane depolarization in the current-clamp mode and increased tonic inward pacemaker currents in the voltage-clamp mode. The application of flufenamic acid or niflumic acid abolished the generation of pacemaker currents, but only treatment with flufenamic acid inhibited the GTS-induced tonic inward currents. The tonic inward currents induced by GTS were not inhibited by the intracellular application of guanosine 5'-[beta-thio]diphosphate trilithium salt. Pretreatment with a Ca(2+)-free solution, with U-73122, an active phospholipase C inhibitor, and with thapsigargin, a Ca(2')-ATPase inhibitor of the endoplasmic reticulum, abolished the generation of pacemaker currents and suppressed the GTS-induced action. However, treatment with chelerythrine and calphostin C, protein kinase C inhibitors, did not block the GTS-induced effects on the pacemaker currents. These results suggest that ginsenosides modulate the pacemaker activities of the ICC, and the ICC can be targets for ginsenosides, and their interaction can affect intestinal motility. [Abstract/Link to Full Text]

Ishikawa M, Kawase I, Ishii F
Glycine inhibits melanogenesis in vitro and causes hypopigmentation in vivo.
Biol Pharm Bull. 2007 Nov;30(11):2031-6.
The simplest amino acid, glycine, is important in protein composition and plays a significant role in numerous physiological events in mammals. Despite the inhibitory effect of glycine on spontaneous melanogenesis in B16F0 melanoma cells, the details of the underlying mechanisms remain unknown. The present study was conducted to investigate the further effects and the mechanisms of inhibitory effect of glycine on melanogenesis using B16F0 melanoma cells and hair follicle melanogenesis in C57BL/6J mice. Treatment with glycine (1-16 mM) for 72 h inhibited alpha-melanocyte stimulating hormone (alpha-MSH)-induced melanogenesis in a concentration-dependent manner without any effects on cell proliferation in B16F0 melanoma cells. Treatment with kojic acid (2.5 mM) for 72 h also inhibited alpha-MSH-induced melanogenesis in B16F0 melanoma cells. The highest dose of glycine inhibited the alpha-MSH-induced increment of tyrosinase protein levels in B16F0 melanoma cells. In hair follicle melanogenesis in C57BL/6J mice, treatment with glycine (1250 or 2500 mg/kg, i.p.) for 5 d prevented the decrement of L* and C* values and inhibited the increment of tyrosinase protein levels and melanin content within the skin. Treatment with hydroquinone (100 mg/kg, i.p.) for 5 d had a similar hypopigmenting effect to that of high dose glycine. These results suggest that glycine has an inhibitory effect on melanogenesis that is mediated by down-regulation of tyrosinase protein levels, leading to a hypopigmenting effect in C57BL/6J mice. [Abstract/Link to Full Text]

Fujita T, Ikejima H, Yamagata N, Kudo Y, Hoshi K
In vitro response of immunoregulatory cytokine expression in human monocytic cells to human parvovirus B19 capsid.
Biol Pharm Bull. 2007 Nov;30(11):2027-30.
Human parvovirus B19 is a clinically important pathogen in both children and adults. In adults, it frequently causes acute and chronic arthritis, which may be related to persistent infection. The effect of the capsid of human parvovirus B19 on monocytes, which are thought to be responsible for the first line of defense against parvoviral infection, is not well understood. In this study, we investigated changes in mRNA expression levels of several immunoregulatory cytokines in monocytic cells after treatment with the B19 capsid. When human monocytic cell line THP-1 cells were treated with the B19 capsid, the expression of tumor necrosis factor alpha (TNF-alpha) mRNA was suppressed independently of transforming growth factor beta (TGF-beta) mRNA. In contrast, the level of mRNA for interleukin-1 alpha (IL-1alpha) remained unchanged, and that for interleukin-1 beta (IL-1beta) was slightly increased after the capsid treatment. Flow cytometry demonstrated that THP-1 cells treated with B19 capsid showed no differences in surface expression of CD11a, CD16 and CD33, as compared with control cells. These findings that B19 capsid antigen did not promote positive responses for production of TNF-alpha and IL-1alpha may provide insight into the mechanisms of persistent infection of human parvovirus B19 and the systemic viral spread via bloodstream. [Abstract/Link to Full Text]

Guo L, Zhao YY, Zhao YY, Sun ZJ, Liu H, Zhang SL
Toxic effects of TCDD on osteogenesis through altering IGFBP-6 gene expression in osteoblasts.
Biol Pharm Bull. 2007 Nov;30(11):2018-26.
Since 2,3,7,8-tetrachlorodibenzo-p-dioxin (TCDD) has reproductive and developmental toxicity as an estrogen antagonist, we investigated the effects of TCDD on osteogenesis in rat skeleton and the human female-responsive osteoblastic osteosarcoma cell line SaOS-2. Rat fetuses were exposed to 5, 10, or 15 microg/kg TCDD on gestation day (GD) 10. TCDD dose-dependently induced single or multiple rat fetal skeletal development malformations in vivo. In vitro, 10 nM TCDD significantly inhibited cell proliferation in the presence of 1 microM 17-beta-estradiol (E2) in SaOS-2 cells. Insulin-like growth factor binding protein 6 (IGFBP-6), as a crucial regulator in IGF system, plays an important role in osteogenesis and bone function. TCDD (15 microg/kg) induced a dramatic 3-fold increase in IGFBP-6 mRNA expression in rat fetal calvaria on GD 21. On the other hand, the concurrent treatment of 10 nM TCDD and 1 muM E2 resulted in a significant increase in IGFBP-6 mRNA and protein after 24 h in SaOS-2 cells, but TCDD and (or) E2 had no effect on the mRNA level of cytosolic aromatic hydrocarbon receptor. The functional estrogen-responsive element (ERE) [5'-CCT TCA CCT G-3'] (-9 to +1) in the IGFBP-6 promoter region was identified in this study for the first time as the ER genomic binding site. Collectively, these results suggest that TCDD can alter the expression of IGFBP-6 gene and exerts growth-inhibitory effects on osteogenesis. In addition, TCDD exhibits an anti-estrogenic effect through its interference with the binding of activated estrogen-liganded ER to the functional ERE in IGFBP-6 gene promoter. [Abstract/Link to Full Text]

Arata Y, Ishii N, Tamura M, Nonaka T, Kasai K
Identification of the amino acid residue in the nematode galectin LEC-1 responsible for its unique sugar binding property: analysis by combination of site-directed mutagenesis and frontal affinity chromatography.
Biol Pharm Bull. 2007 Nov;30(11):2012-7.
The basic disaccharide structure recognized by galectin family members is the lactosamine-like structure Galbeta1-4(3)Glc(NAc). In galectins, eight highly conserved amino acid residues participate in the recognition of this basic structure. Each galectin seems to mediate diverse biological functions due to recognition of different modifications of the basic disaccharide Galbeta1-4(3)Glc(NAc), but there is very little information about which amino acid residue in galectin is responsible for recognizing these modifications. The 32-kDa galectin LEC-1 of the nematode Caenorhabditis elegans is composed of two domains, each of which is homologous to vertebrate 14-kDa-type galectins. Although both lectin domains have an affinity for N-acetyllactosamine (Galbeta1-4GlcNAc)-containing, N-linked, complex-type sugar chains, the N-terminal lectin domain of LEC-1 recognizes blood group A saccharide (GalNAcalpha1-3(Fucalpha1-2)Galbeta1-3GlcNAc), whereas this saccharide is only poorly recognized by the C-terminal domain. Here, we used a combination of site-directed mutagenesis of the N-terminal lectin domain of galectin LEC-1 and an analysis of the sugar-binding profile by frontal affinity chromatography to identify the amino acid residues important for this recognition. Our results indicate that Thr(41) in the N-terminal lectin domain of LEC-1 is important for its affinity for A-hexasaccharide. [Abstract/Link to Full Text]

Yokozawa T, Kim YJ
Piceatannol inhibits melanogenesis by its antioxidative actions.
Biol Pharm Bull. 2007 Nov;30(11):2007-11.
In our efforts to find new skin lightening agents, piceatannol (PICE) was investigated for its antioxidative property and ability to inhibit melanogenesis. In this study, PICE's effect on inhibition of mushroom tyrosinase, and tyrosinase inhibiting activity and melanin content were assessed utilizing the B16F10 melanoma cell (B16 cell) culture system. Results indicated that PICE has a strong antityrosinase activity (IC(50)=1.53 microM). To evaluate the relative efficacy of PICE compared to other tyrosinase inhibitors, its inhibitory effect was compared and showed that PICE was significantly stronger than kojic acid (IC(50)=50.1 microM) and resveratrol (IC(50)=63.2 microM). Furthermore, PICE was shown to down-regulate melanin content. To document PICE's antioxidative property, which is known to influence melanogenic activity, we assessed reactive species (RS) generation, reduced glutathione (GSH) and oxidized glutathione (GSSG) levels in these B16 cells. The results showed that PICE suppressed RS generation and enhanced the GSH/GSSG ratio. In conclusion, our results indicated that the antimelanogenic action of PICE is likely exhibited by the combined effect of PICE's antioxidative property and its ability to suppress RS generation while increasing the GSH/GSSG ratio. [Abstract/Link to Full Text]

Ohsugi Y
Recent advances in immunopathophysiology of interleukin-6: an innovative therapeutic drug, tocilizumab (recombinant humanized anti-human interleukin-6 receptor antibody), unveils the mysterious etiology of immune-mediated inflammatory diseases.
Biol Pharm Bull. 2007 Nov;30(11):2001-6.
Interleukin (IL)-6 cDNA was originally cloned as a terminal B cell differentiation factor into antibody-producing plasma cells. This revealed that it is a multifunctional cytokine that acts on a variety of cells. From the clinical viewpoint, it is especially important that IL-6 acts on hepatocytes to induce acute-phase reactants, including C-reactive protein, serum amyloid A protein, and fibrinogen, and to decrease serum albumin levels. Very recently, this cytokine has been found to enhance the synthesis of a peptide called hepcidin in the liver which regulates iron recycling, resulting in anemia due to hypofferemia. It has also been shown that IL-6 is responsible for various clinical symptoms, including the appearance of autoantibodies, fatigue, anemia, anorexia, fever, and increases in the erythrocyte sedimentation rate, all of which develop in patients with various chronic autoimmune inflammatory diseases. In practice, blocking the IL-6 signaling pathway with a recombinant humanized anti-IL-6 receptor antibody, tocilizumab (TCZ), has dramatically improved all the signs and symptoms of these patients. A study in mice demonstrated that IL-6 promotes the development of a new type of T-helper cells called Th17 cells that impact the pathogenesis of autoimmune diseases. This suggests that TCZ is not only an antiinflammatory agent but also might affect basic autoimmunity. In this review, recent advances in the immunobiology of interleukin-6 related to immune-mediated diseases are discussed. [Abstract/Link to Full Text]

Inoue K, Itoh K, Yoshida K, Higuchi H, Kamata M, Takahashi H, Shimizu T, Suzuki T
No association of the G1287A polymorphism in the norepinephrine transporter gene and susceptibility to major depressive disorder in a Japanese population.
Biol Pharm Bull. 2007 Oct;30(10):1996-8.
Norepinephrinergic neurotransmission in the central nervous system have a major impact on the symptomatology in major depressive disorder (MDD), and genetic polymorphisms of norepinephrine transporter (NET) have a possibility to be involved in susceptibility to MDD. We investigated the association of the G1287A (rs5569) polymorphism of the NET gene and susceptibility to MDD by comparing 145 major depressive patients with 164 healthy individuals first in a Japanese population. The genotype frequencies in depressed patients and health volunteers of the NET G1287A polymorphism were 52.4% (G/G), 39.3% (G/A) and 8.3% (A/A) in depressed patients, 61.6% (G/G), 29.9% (G/A allele) and 8.5% (A/A) in healthy volunteers, respectively. The allele frequencies in depressed patients and health volunteers of the NET G1287A polymorphism were 72.1% (G allele) and 27.9% (A allele) in depressed patients, 76.5% (G allele) and 23.5% (A allele) in healthy volunteers, respectively. The genotype distribution and allele frequencies were not significantly different between major depressive patients and healthy volunteers. NET G1287A polymorphism appears not to be an important factor in susceptibility to MDD in a Japanese population. [Abstract/Link to Full Text]

Lee SK, Kim GH, Kim DH, Kim DH, Jahng Y, Jeong TC
Identification of a tryptanthrin metabolite in rat liver microsomes by liquid chromatography/electrospray ionization-tandem mass spectrometry.
Biol Pharm Bull. 2007 Oct;30(10):1991-5.
Tryptanthrin originally isolated from Isatis tinctoria L. has been characterized to have anti-inflammatory activities through the dual inhibition of cyclooxygenase-2 and 5-lipoxygenase mediated prostaglandin and leukotriene syntheses. To characterize phase I metabolite(s), tryptanthrin was incubated with rat liver microsomes in the presence of NADPH-generating system. One metabolite was identified by liquid chromatography/electrospray ionization-tandem mass spectrometry. M1 could be identified as a metabolite mono-hydroxylated on the aromatic ring of indole moiety from the MS(2) spectra of protonated tryptanthrin and M1. The structure of metabolite was confirmed as 8-hydroxytryptanthrin with a chemically synthesized authentic standard. The formation of M1 was NADPH-dependent and was inhibited by SKF-525A, a general CYP-inhibitor, indicating the cytochrome P450 (CYP)-mediated reaction. In addition, it was proposed that M1 might be formed by CYP 1A in rat liver microsomes from the experiments with enriched rat liver microsomes. [Abstract/Link to Full Text]

Yokoyama H, Yamamura Y, Ozeki T, Iga T, Yamada Y
Kinetic analysis of effects of mouth washing on removal of drug residues following inhalation of fluticasone propionate dry powder.
Biol Pharm Bull. 2007 Oct;30(10):1987-90.
Fluticasone propionate dry powder inhaler (FP-DPI) is widely used for the treatment of asthma. However, local adverse effects such as oropharyngeal candidiasis are often seen and mouth washing after inhaling is recommended. In our previous study, we reported a nonlinear relationship between the amount of drug residue and number of times mouth washing was employed. Thus, we developed a compartment model, in which the inhaled drugs were distributed in both easy and difficult to remove areas. Using this model, we analyzed drug removal efficiency in each area with different mouth washing procedures. Three methods of mouth washing were studied; gargling and rinsing in combination, rinsing alone, and gargling alone, following administration of FP-DPI by sprinkling or inhaling. The amounts of drugs recovered from areas considered to be easy to remove (X(1)) and difficult to remove (X(2)) were determined using a nonlinear least-squares program, while the removal efficiency of each of the 3 methods was also calculated. The ratios of X(1) after sprinkling and inhalation were 63.9% and 21.8%, respectively, while those of X(2) were 6.0% and 12.4%, respectively. The numbers of mouth washings required to remove half doses from easy and difficult to remove areas were 0.2 and 1.4 times, respectively, with a combination of gargling and rinsing following inhalation of FP-DPI, while those were 0.3 and 3.6 times, respectively, with rinsing alone, and 0.4 and 5.8 times, respectively, with gargling only, thus demonstrating significant differences among the mouth washing methods for efficiency in the difficult to remove area. The present results show that the employed methods of mouth washing had a significant influence on the removal of drug residues following inhalation of FP-DPI, with gargling and rinsing in combination considered to be the most effective. [Abstract/Link to Full Text]

Tsukura Y, Mori M, Hirotani Y, Ikeda K, Amano F, Kato R, Ijiri Y, Tanaka K
Effects of capsaicin on cellular damage and monolayer permeability in human intestinal Caco-2 cells.
Biol Pharm Bull. 2007 Oct;30(10):1982-6.
Recent studies suggest that capsaicin (Cap), a major constituent of hot pepper, may affect the function and permeability of the intestinal mucosa in vitro. However, the relationships between the dose of Cap and the barrier and/or transporter functions on intestinal epithelial cells are unknown. The aim of this study was to investigate whether Cap initiates cellular injury and alter epithelial permeability in Caco-2 cells. Cellular toxicity, as measured using a lactate dehydrogenase release assay, was not observed at high concentrations of Cap (up to 300 microM). When cell viability was measured by a WST-1 assay (tetrazolium salt-based assay), damage to Caco-2 monolayers was observed at doses of 200 and 300 microM of Cap. The barrier function of tight junctions was assessed by measuring transepithelial electrical resistance (TEER) in Caco-2 cells. Treatment of Caco-2 cells with Cap at doses above 100 microM significantly decreased the TEER compared to treatment with buffer alone for 2 h (p<0.05). We next examined the effects of Cap on the activity of P-glycoprotein (P-gp) found on transcellular transporters. At doses of 100 and 200 microM, Cap inhibited the transport of rhodamine 123 by P-gp-mediated efflux in Caco-2 cells. Cap thus exhibited inhibitory effects on P-gp. The results of this study indicate that Cap, a dietary phytochemical, causes functional and structural changes in Caco-2 cell monolayers at noncytotoxic doses (less than 100 microM of Cap). The concomitant administration of Cap with drugs that are substrates of P-gp might increase the plasma concentrations of such drugs. [Abstract/Link to Full Text]

Kitagawa S, Takahashi T, Nabekura T, Tachikawa E, Hasegawa H
Inhibitory effects of ginsenosides and their hydrolyzed metabolites on daunorubicin transport in KB-C2 cells.
Biol Pharm Bull. 2007 Oct;30(10):1979-81.
We studied the effects of ginsenosides and their metabolites on daunorubicin transport in multidrug-resistant P-glycoprotein (P-gp)-overexpressing KB-C2 cells. Ginsenoside Rg1, which is a protopanaxatriol-type ginseng saponin, did not have any effects on the accumulation of P-gp substrate daunorubicin. On the other hand, its metabolite M4, which has no sugar moiety, increased the accumulation 3.6-fold at 5 microM. Metabolites of protoanaxadiol-type saponin M1 and M12 also increased accumulation, but the effects were less than that of M4. The findings showed larger effects of metabolites without glucose moieties. Analysis of verapamil-stimulated ATPase activity in membrane vesicles expressing human P-gp suggested that the increased daunorubicin accumulation by M4 was at least partly due to ATPase inhibition of P-gp. [Abstract/Link to Full Text]

Kang KS, Lee YJ, Park JH, Yokozawa T
The effects of glycine and L-arginine on heat stability of ginsenoside Rb1.
Biol Pharm Bull. 2007 Oct;30(10):1975-8.
To identify the effects of amino acids on the heat stability of ginsenoside Rb(1) (Rb(1)), Rb(1) was heat-processed at 120 degrees C with or without glycine or L-arginine. Rb(1) was changed into 20(S)-Rg(3), 20(R)-Rg(3), Rk(1), and Rg(5) by heat-processing through glycosyl elimination and epimerization of carbon-20 by SN1 reaction. Similarly, Rb(1) was changed into 20(S)-Rg(3), 20(R)-Rg(3), Rk(1), and Rg(5) when it was heat-processed with the same amount of glycine, but the generated amount of 20(S)-Rg(3) was higher than when Rb(1) was heat-processed without amino acids, and a significant increase in Maillard reaction products (MRPs) was noted. On the other hand, there were no structural changes in Rb(1) and the generation of MRPs when Rb(1) was heat-processed with the same amount of L-arginine. The improved heat stability of Rb(1) brought about by the addition of L-arginine was thought to be closely related to its characteristics of interfering with nonenzymatic glycation and forming hydrogen bonds with Rb(1). [Abstract/Link to Full Text]

Efdi M, Ohguchi K, Akao Y, Nozawa Y, Koketsu M, Ishihara H
N-trans-feruloyltyramine as a melanin biosynthesis inhibitor.
Biol Pharm Bull. 2007 Oct;30(10):1972-4.
In this study, we examined the effect of N-trans-feruloyltyramine (FA) on melanogenesis in mouse B16 melanoma cells. Melanogenesis was inhibited by FA in a dose-dependent manner. FA exhibited a greater potency than kojic acid as a standard inhibitor of melanogenesis. Moreover, treatment of B16 melanoma cells with FA was found to cause marked decreases in the expression levels of tyrosinase. FA-induced downregulation of tyrosinase resulted in suppression of melanin biosynthesis in murine B16 melanoma cells. [Abstract/Link to Full Text]

Jung HJ, Park K, Lee IS, Kim HS, Yeo SH, Woo ER, Lee DG
S-phase accumulation of Candida albicans by anticandidal effect of amentoflavone isolated from Selaginella tamariscina.
Biol Pharm Bull. 2007 Oct;30(10):1969-71.
Amentoflavone, which is a biflavone derived from various plants, has been known to possess various biological activities including anti-tumor and anti-inflammatory activity. In the previous study, we reported antifungal effect of amentoflavone isolated from an ethyl acetate extract of Selaginella tamariscina on human pathogenic fungi. Amentoflavone significantly inhibited the growth of fungal cells without hemolysis of human erythrocytes. In the present study, we investigated antifungal acting mode of amentoflavone in human pathogenic yeast Candida albicans. Anticandidal activity was exerted in an energy-independent manner presented by an antifungal assay in the presence of NaN(3), which is ATP-depleting agent as a metabolic inhibitor. To investigate the effects of amentoflavone on cellular physiology in C. albicans, we performed cell cycle analysis, and the analysis showed that amentoflavone significantly arrested cell cycles during the S-phase. These results demonstrated that amentoflavone has potent anticandidal activity with significant physiological changes inducing S-phase arrest in intracellular environment. Therefore, amentoflavone may be applied to a lead compound for the development of therapeutic agents, which can treat candidiasis resulted from candidal infections. [Abstract/Link to Full Text]

Min SW, Kim DH
Kakkalide and irisolidone: HMG-CoA reductase inhibitors isolated from the flower of Pueraria thunbergiana.
Biol Pharm Bull. 2007 Oct;30(10):1965-8.
As part of our search for anti-arteriosclerosis agents from traditional Chinese medicines, the 3-hydroxy-3-methylglutaryl (HMG)-CoA reductase (HCR)-inhibitory constituent, kakkalide, was isolated from the flower of Pueraria thunbergiana (PT, family Leguminosae). The antihyperlipidemic effects of kakkalide and its metabolite, irisolidone, which may be a bioactive form in vivo and potently inhibit the HCR activity, were investigated in vivo. Both the oral and interperitoneal administrations of kakkalide and irisolidone, with the exception of intraperitoneally treated kakkalide, potently lowered the serum levels of total cholesterol (TC) and triglyceride (TG) in Trition WR1339-induced hyperlipidemic mice. The oral administrations of kakkalide and irisolidone in hyperlipidemic mice induced, by the long-term feeding of a high fat diet, also potently reduced the serum levels of TC and TG and epididymal fat pad weight. These findings suggest that PT can improve hyperlipidemia, and the hypolipidemic effect may be due to HMG-CoA reductase. [Abstract/Link to Full Text]

Ping Y, Ogawa W, Kuroda T, Tsuchiya T
Gene cloning and characterization of KdeA, a multidrug efflux pump from Klebsiella pneumoniae.
Biol Pharm Bull. 2007 Oct;30(10):1962-4.
We cloned a gene related to multidrug resistance from a drug-resistant Klebsiella pneumoniae strain MGH78578. We designated the gene kdeA, which encodes a protein possessing 12 hydrophobic regions. The deduced amino acid sequence of KdeA is similar to that of MdfA, a well-characterized multidrug efflux pump from Escherichia coli. Introduction of the kdeA gene into cells of the drug-hypersusceptible E. coli strain KAM32 resulted in elevated minimum inhibitory concentrations of chloramphenicol, norfloxacin, acriflavine, and ethidium bromide. We observed elevated energy-dependent ethidium efflux activity with cells carrying kdeA compared with control cells. We also observed expression of kdeA in cells of K. pneumoniae under normal growth conditions. [Abstract/Link to Full Text]

Futami K, Takagi M, Shimamoto A, Sugimoto M, Furuichi Y
Increased chemotherapeutic activity of camptothecin in cancer cells by siRNA-induced silencing of WRN helicase.
Biol Pharm Bull. 2007 Oct;30(10):1958-61.
Werner syndrome helicase (WRN) participates in a wide range of DNA activities, including replication, double-strand DNA break repair, telomere and retrovirus long terminal repeat maintenance. Mutations of the WRN gene cause Werner syndrome (WS), an autosomal recessive premature ageing disorder associated with various symptoms related to ageing. In this study, we investigated the siRNA that specifically down-regulates WRN expression. WRN silencing increased markedly the chemotherapeutic activity of camptothecin (CPT) on cancer cells in terms of the extent of efficacy and lowering effective drug dosage, accompanied by suppressing recovery from DNA damage caused by CPT. Here, we propose a potential combination therapy of WRN-siRNA and CPT, looking forward to minimizing the inevitable adverse effects associated with cancer chemotherapy. [Abstract/Link to Full Text]

Nagai F, Shimizu M, Sakamoto T, Kobayashi T, Tamura H
Changes in the expression of cytochrome P450 genes in hemin-induced differentiated K562 cells.
Biol Pharm Bull. 2007 Oct;30(10):1954-7.
We have previously reported the expression of CYP genes in human myeloblastic and lymphoid cell lines, and the induction of the CYP3A4 and GSTP1 genes by oxidative stress in the human erythroleukemia cell line, K562. To further elucidate the role of drug metabolizing enzymes in hematogenesis, we have characterized the expression of CYP genes in hemin-induced differentiated K562 cells. After incubation with 50 microM hemin for 3 d, the expression of CYP1A1 and CYP3A4 genes was induced by 2.5- and 3.5-fold, respectively. In contrast, the CYP1B1 and CYP2E1 genes were downregulated in these cells to below 10% of the control levels. Moreover, these changes correlated with the hemin dose and culture time. Metabolism of midazolam, a probe substrate for CYP3A4, in the differentiated K562 cells increased by 2-folds, suggesting that the induction of CYP3A4 activity is consistent with the mRNA level. If these changes in the CYP expression profile in hematopoietic cells occurred, the susceptibility to xenobiotics and/or the therapeutic drugs of the cells might be influenced, and it also affects the metabolism of endogenous substrates, such as steroids and prostaglandins. [Abstract/Link to Full Text]

Shimizu H, Ohgoh M, Ikeda M, Nishizawa Y, Ogura H
Caspase-3-like protease activity-independent apoptosis at the onset of neuronal cell death in the gerbil hippocampus after global ischemia.
Biol Pharm Bull. 2007 Oct;30(10):1950-3.
To investigate the relationship between caspase-3-like protease activity, which has been suggested to be related to apoptosis, and DNA fragmentation, we measured changes in caspase-3-like activity and DNA fragmentation in the hippocampus of gerbils exposed to global ischemia induced by bilateral occlusion of the carotid arteries for 5 min. Caspase-3-like protease activity began to increase at day 4 post-ischemia, reached a peak at day 5, and declined thereafter. The levels of DNA fragmentation, evaluated in terms of terminal deoxynucleotidyl transferase (TdT)-mediated dUTP-biotin nick-end labeling (TUNEL) staining and cytosolic nucleosomes, in the ischemic hippocampus began to increase significantly at day 3 after ischemia, reached a peak at day 4, and decreased thereafter. Our data suggest that DNA fragmentation in ischemic hippocampus of gerbils precedes caspase-3-like protease activation. Our results indicate that a caspase-3-like protease-independent apoptotic pathway operates, at least at the onset of neuronal cell death, in the hippocampus of gerbils after global ischemia. [Abstract/Link to Full Text]

Takahashi M, Kudaka Y, Okumura N, Hirano A, Banno K, Kaneda T
The validation of plasma darunavir concentrations determined by the HPLC method for protease inhibitors.
Biol Pharm Bull. 2007 Oct;30(10):1947-9.
Darunavir (DRV) is a new protease inhibitor used to treat human immunodeficiency virus (HIV) type-1. The aim of this study was to validate the determination of plasma DRV concentrations using the HPLC method, a simple procedure for simultaneous determination of seven HIV protease inhibitors and efavirenz. The calibration curve was linear (range of 0.13 to 10.36 microg/ml). The average accuracy ranged from 100.7 to 105.6%. Both the interday and intraday coefficients of variation were less than 6.7%, which was similar to or much lower than previously reported values by the LC/MS/MS method. It is concluded that HPLC can be used to determine plasma DRV concentrations and routinely in the clinical setting; thus, this HPLC method enables further study of DRV pharmacokinetics in conventional hospital laboratories. [Abstract/Link to Full Text]

Samejima K, Otani M, Murakami Y, Oka T, Kasai M, Tsumoto H, Kohda K
Electrospray ionization and time-of-flight mass spectrometric method for simultaneous determination of spermidine and spermine.
Biol Pharm Bull. 2007 Oct;30(10):1943-6.
A sensitive method for the determination of polyamines in mammalian cells was described using electrospray ionization and time-of-flight mass spectrometer. This method was 50-fold more sensitive than the previous method using ionspray ionization and quadrupole mass spectrometer. The method employed the partial purification and derivatization of polyamines, but allowed a measurement of multiple samples which contained picomol amounts of polyamines. Time required for data acquisition of one sample was approximately 2 min. The method was successfully applied for the determination of reduced spermidine and spermine contents in cultured cells under the inhibition of aminopropyltransferases. In addition, a new proper internal standard was proposed for the tracer experiment using (15)N-labeled polyamines. [Abstract/Link to Full Text]

Recent Articles in Chemical & Pharmaceutical Bulletin (Tokyo)

Anzai K, Mizoguchi J, Yanagi T, Hirayama F, Arima H, Uekama K
Improvement of dissolution properties of a new Helicobacter pylori eradicating agent (TG44) by inclusion complexation with beta-cyclodextrin.
Chem Pharm Bull (Tokyo). 2007 Oct;55(10):1466-70.
The interaction of a newly developed Helicobacter pylori eradicating agent (TG44, 4-methylbenzyl-4'-[trans-4-(guanidinomethyl)cyclohexylcarbonyloxy]biphenyl-4-carboxlylate monohydrochloride) with beta-cyclodextrin (beta-CyD) in aqueous solution and in solid state was studied to gain insight into the high in-vivo H. pylori eradicating activity of TG44/beta-CyD complex. The interaction was studied by the solubility method, spectroscopic methods, powder X-ray diffractometry and differential scanning colorimetry (DSC). TG44 gave A(L)-type phase solubility diagram with beta-CyD in water, showing a linear increase in solubility of the drug up to 8 mM beta-CyD concentration. The solubility of TG44 (0.04 mM in water at 25 degrees C) increased about 70-folds at 8 mM beta-CyD. Ultraviolet, circular dichroism, fluorescence and (1)H-nuclear magnetic resonance spectroscopic studies indicated that TG44 forms the inclusion complex with beta-CyD in a 1:1 stoichiometry and the biphenyl moiety of TG44 is preferably included in the beta-CyD cavity in water. The Giordano plot made by monitoring changes in the fusion enthalpy of TG44 (about 184 degrees C) suggested that TG44 forms the 1:1 complex with beta-CyD in the solid state. The TG44/beta-CyD solid complex in a 1:1 stoichiometry was prepared by the grinding and spray-drying methods and confirmed by powder X-ray diffractometry and DSC that the complex is in an amorphous state. The initial dissolution rate of TG44/beta-CyD complex was significantly faster than those of the drug alone and the physical mixture of both components, maintaining higher supersaturated concentrations of the drug for a long time. The results suggested that the higher eradicating activity of TG44/beta-CyD complex to Helicobacter pylori, compared with that of the drug alone, is attributable at least partly to the faster dissolving property of the complex and its ability to maintain the supersaturated state of the drug in the gastric fluid. [Abstract/Link to Full Text]

Kakehi A, Suga H, Okuno H, Okuhara M, Ohta A
Preparation of new nitrogen-bridged heterocycles. 60. Syntheses and conformational analyses of bis(indolizin-1-yl) disulfides.
Chem Pharm Bull (Tokyo). 2007 Oct;55(10):1458-65.
Some bis(indolizin-1-yl) disulfides, readily obtainable from the treatment of 1-(benzoylthio)indolizines with piperidine, were prepared and their conformations were investigated. In comparison with those of 1-(benzoylthio)indolizines, the (1)H-NMR spectra of these disulfides showed considerable high field shifts (delta 0.13-0.82 ppm) on each pyridine ring proton and the UV spectra exhibited significant bathochromic and hyperchromic shifts. These results supported strongly the participation of an intramolecular pi-pi interaction between the two indolizine rings in these molecules and, hence, of a particular gauche (cis) conformation. However, the conformational considerations and molecular calculations (Mopac PM3) for some bis(indolizin-1-yl) disulfides showed the presence of four more stable gauche forms in which two are enantiomeric, resulting in three types of gauche structures. These three types of gauche structures were confirmed by X-ray analyses. [Abstract/Link to Full Text]

Ishizaka T, Okada S, Takemoto E, Tokuyama E, Tsuji E, Mukai J, Uchida T
The suppression of enhanced bitterness intensity of macrolide dry syrup mixed with an acidic powder.
Chem Pharm Bull (Tokyo). 2007 Oct;55(10):1452-7.
The aim of the present study was to identify a medicine which strongly enhanced the bitterness of clarithromycin dry syrup (CAMD) when administered concomitantly and to develop a method to suppress this enhanced bitterness. The bitterness enhancement was evaluated not only by gustatory sensation tests but also using pH and taste sensor measurements of the mixed sample. A remarkable bitterness enhancement was found when CAMD was mixed with the acidic powder L-carbocysteine. The acidic pH (pH 3.40) of the suspension made from these two preparations, seemed to be due to enhanced release of clarithromycin caused by the dissolution of the alkaline polymer film-coating. Several methods for preventing this bitterness enhancement were investigated. Neither increasing the volume of water taken with the mixture, nor changing the ratio of CAMD:L-carbocysteine in the mixture, were effective in reducing the bitterness intensity of the CAMD/L-carbocysteine mixture. The best way to achieve taste masking was to first administer CAMD mixed with chocolate jelly, which has a neutral pH, followed by the L-carbocysteine suspension. Similar results were obtained for the bitterness suppression of azithromycin fine granules with L-carbocysteine. The chocolate jelly will be useful for taste masking of bitter macrolide drug formulations, when they need to be administered together with acidic drug formulations. [Abstract/Link to Full Text]

Shimpi S, Mahadik K, Takada K, Paradkar A
Application of polyglycolized glycerides in protection of amorphous form of etoricoxib during compression.
Chem Pharm Bull (Tokyo). 2007 Oct;55(10):1448-51.
Polymorphic transition and stability problems during amorphous drug formulation are the major limiting factors in pharmaceutical technology. The purpose of the study was to evaluate the ability of polyglycolized glycerides (Gelucire) in protection of amorphous form of drug during compression and shelf life with lower proportion. Amorphous etoricoxib (AET) was prepared by spray drying technique. Tablets of AET and melt granules of AET (MG-AET) with Gelucire 50/13 were prepared. Tablets parameters like hardness, disintegration and content uniformity were evaluated. Tablets were evaluated immediately after compression and on storage for 3 months at ambient conditions to determine degree of transformation using X-ray powder diffraction (XRPD), differential scanning calorimetry (DSC) and dissolution profiles. Spray drying yielded the amorphous etoricoxib. Content uniformity in the tablet was in between 95 to 105%. Other parameters like disintegration and hardness were well within the limits. The results showed significant difference in the degree of crystallinity between AET tablet and MG-AET tablet. MG-AET tablet showed absence of crystallinity after 3 months storage. The reason could be formation of hydrogen bonding between the Gelucire and AET. Also Gelucire can be tableted very easily under low pressure and showed elastic recovery. Gelucire yielded a soft embedding during tableting, which prevented the polymorphic transformation. Polyglycolized glycerides (Gelucire 50/13) are able to protect amorphous etoricoxib during compression. As excipient required is low, it became possible to prepare tablet formulation as compared to other excipient like polyvinylpyrrolidon (PVP). [Abstract/Link to Full Text]

Mitsui K, Saito H, Yamamura R, Fukaya H, Hitotsuyanagi Y, Takeya K
Apotirucallane and tirucallane triterpenoids from Cedrela sinensis.
Chem Pharm Bull (Tokyo). 2007 Oct;55(10):1442-7.
Nine new triterpenoids, 1-9, were isolated from the cortex of Cedrela sinensis (Meliaceae), together with six known compounds, sapelin E acetate, grandifoliolenone, azadirone, bourjotinolone A, piscidinol A, and hispidol B. The structures of 1-9 were determined by the 2D NMR experiments, chemical methods, and X-ray crystallography. [Abstract/Link to Full Text]

Wang H, Chen M, Wang L
Selective synthesis and utility of one tripyrrolic compound and its intermediates.
Chem Pharm Bull (Tokyo). 2007 Oct;55(10):1439-41.
Highly selective syntheses of tri(2,4-dimethyl-3-carbethoxypyrrolyl)-methane 8 and its dipyrrolic intermediate 6 and pyrrolic one 1 are described based on the successful correction of the wrong process for 1 in literature. Tripyrrolic compounds have attracted much attention recently and been developed in diverse fields. 1 was the key intermediate for some tyrosine kinase inhibitors, including newly-launched Sutent, and most recently we have found 6 was also synthetically useful in the synthesis of 11 that has been discovered as a novel histone deacetylases (HDAC) inhibitor with an IC(50) value of about 1 microM in our assessments and represents a promising lead for the development of more potent histone deacetylase inhibitors (HDACIs). [Abstract/Link to Full Text]

Nakajima A, Tahara M, Yoshimura Y, Nakazawa H
Study of compounds suppressing free radical generation from UV-exposed ketoprofen.
Chem Pharm Bull (Tokyo). 2007 Oct;55(10):1431-8.
Ketoprofen [(RS)-2-(3-benzoylphenyl)propanoic acid] is widely used for the treatment of inflammatory diseases and musculoskeletal injury. However, there is concern regarding its potential for photosensitization as a side effect. Free radicals and active oxygen species generated from ketoprofen on exposure to ultraviolet (UV) light have been implicated in phototoxicity and photosensitization. In this study, we examined the suppressing ability of some compounds for the free radicals and active oxygen species generated by the photodynamic reaction of ketoprofen, to determine a new resist of photosensitization by ketoprofen. Eight compounds, including six known free radical scavengers were individually mixed with ketoprofen, and the mixtures were exposed to UV. Then, the free radicals and the active oxygen species were determined by the electron spin resonance spectrometry to estimate suppressing and scavenging ability of compounds. The compounds that show promise in suppressing superoxide anion generation from UV-exposed ketoprofen were further evaluated using the on-line photo-irradiated superoxide anion detection system. It was confirmed that quercetin, a flavonoid, strongly suppresses the generation of free radicals and active oxygen species from UV-exposed ketoprofen. The experiments using the experimental formulation of an adhesive skin patch of ketoprofen containing quercetine and the Chemiluminescence analyzer (CLA) indicated that quercetin has high potential for use as an excipient in ketoprofen ointments to suppress phototoxicity and photosensitization by ketoprofen. [Abstract/Link to Full Text]

Souri E, Jalalizadeh H, Shafiee A
Optimization of an HPLC method for determination of gabapentin in dosage forms through derivatization with 1-fluoro-2,4-dinitrobenzene.
Chem Pharm Bull (Tokyo). 2007 Oct;55(10):1427-30.
A rapid, sensitive and accurate high performance liquid chromatography with UV detection method was developed and validated for the quantification of gabapentin in dosage forms. Gabapentin was quantified after pre-column derivatization with 1-fluoro-2,4-dinitrobenzene. Amlodipine was used as an internal standard. The chromatographic separation was carried out on a Nova-Pak C(18) column using a mixture of acetonitrile-sodium dihydrogenphosphate (pH 2.5; 0.05 M) (70:30, v/v) as mobile phase with UV detection at 360 nm. The method was linear over the range of 10-500 microg/ml of gabapentin (r(2)>0.999). The within-day and between-day precision values were in the range of 0.86-1.11%. The method was successfully used for quantitative determination and dissolution rate study of Neurontin capsules. [Abstract/Link to Full Text]

Miti? S, Mileti? G, Pavlovi? A, Tosi? S, Pecev E
Determination of diclofenac sodium in commercial pharmaceutical formulations and human control serum using a kinetic-spectrophotometric method.
Chem Pharm Bull (Tokyo). 2007 Oct;55(10):1423-6.
A kinetic method for the determination of micro quantities of diclofenac sodium (DS) is described in this paper. The method is based on a ligand-exchange reaction. The reaction was followed spectrophotometrically by monitoring the rate of appearance of the cobalt diclofenac complex at 376 nm. The optimum operating conditions regarding reagent concentrations and temperature were established. The optimized conditions yielded a theoretical detection limit of 1.29 microg ml(-1) based on the 3S(b) criterion. The interference effects of certain drugs, foreign ions and amino acids upon the reaction rate were studied in order to assess the selectivity of the method. The developed procedure was successfully applied to the rapid determination of diclofenac sodium in commercial pharmaceutical preparations and human control serum. The unique features of this procedure are that determination can be carried out at room temperature and the analysis time is short. The newly developed method is simple, inexpensive, and efficient for use in the analysis of a large number of samples. [Abstract/Link to Full Text]

Oda K, Yamaguchi Y, Yoshimura T, Wada K, Nishizono N
Synthetic models related to furanocoumarin-CYP 3A4 interactions. comparison of furanocoumarin, coumarin, and benzofuran dimers as potent inhibitors of CYP3A4 activity.
Chem Pharm Bull (Tokyo). 2007 Sep;55(9):1419-21.
Furanocoumarin derivatives (dimers and monomers) present in commercially available grapefruit juice have the capacity to inhibit the activity of human CYP3A4. Such interactions are believed to result from the mechanism-based inhibition of CYP3A4 activity in the intestine. The aim of this work was to synthesize and test a series of dimers with a view to determining the relationship between structure and inhibitory activity and determining whether they might make suitable probes of CYP3A4 activity. We prepared a series of furanocoumarin, coumarin, and benzofuran derivatives that have inhibitory effects on the activity of human CYP3A4. A synthetic benzofuran dimer, which is more accessible than furanocoumarin dimers, exhibited activity against CYP3A4 comparable to that of furanocoumarin dimers. [Abstract/Link to Full Text]

Chen H, Zhou YZ, Qiao L, Cao JQ, Yao Y, Hua HM, Pei YH
Androstane and monoterpene glucoside sinapoyl ester from Cynanchum amplexicaule SIEB. et ZUCC.
Chem Pharm Bull (Tokyo). 2007 Sep;55(9):1416-8.
A new androstane, 17beta-hydroxy-androsta-4,6,15-trien-3-one (1) and a new monoterpene glucoside sinapoyl ester, (3R)-8-hydroxylinalool 3,8-di-O-beta-D-(6'-O-E-sinapoyl)glucopyranoside (2) were isolated from the roots of Cynanchum amplexicaule SIEB. et ZUCC. (Asclepiadaceae), along with two known monoterpenes, (3R)-8-hydroxylinalool (3) and (6R)-menthiafolic acid (4). Their structures were elucidated on the basis of analyses of physical, chemical, and spectral data. [Abstract/Link to Full Text]

Huang HC, Tsai WJ, Liaw CC, Wu SH, Wu YC, Kuo YH
Anti-platelet aggregation triterpene saponins from the galls of Sapindus mukorossi.
Chem Pharm Bull (Tokyo). 2007 Sep;55(9):1412-5.
Bioassay-directed fractionation of an ethanolic extract of the galls of Sapindus mukorossi has resulted in the isolation of two new tirucallane-type triterpenoid saponins, sapinmusaponins Q (1) and R (2), along with three known oleanane-type triterpenoid saponins (3-5). Their structures were elucidated on the basis of spectroscopic analysis and chemical hydrolysis. Biological evaluation showed that both sapinmusaponins Q and R demonstrated more potent anti-platelet aggregation activity than aspirin. [Abstract/Link to Full Text]

Mibu N, Yokomizo K, Miyata T, Sumoto K
N-monocarbamoyl derivatives of symmetrical diamines with antiviral activity.
Chem Pharm Bull (Tokyo). 2007 Sep;55(9):1406-11.
Some new N-monocarbamoyl symmetrical diamines have been prepared by the addition of symmetrical amines to isocyanates or isothiocyanates. 2,6-Diaminopyridine (1), (1R,2R)-1,2-diaminocyclohexane [(1R,2R)-2], meso-1,2-diaminocyclohexane (meso-2), or (1R,2R)-1,2-diphenylethylenediamine (3) were used as the starting symmetrical diamine frameworks. All of the newly synthesized compounds were subjected to an evaluation of antiviral activity with herpes simplex virus (HSV)-1. N-Monocarbamoyl 2,6-diaminopyridines (5a, b) showed significant antiviral activity (EC(50)=17.0, 6.2 microg/ml) comparable to that of N-monododecanoyl 2,6-diaminopyridine (A2). As a result, compound 5a showed a better selectivity index (CC(50)/EC(50) = ca. 10.0) than that of A2. [Abstract/Link to Full Text]

Pongcharoen W, Rukachaisirikul V, Phongpaichit S, Sakayaroj J
A new dihydrobenzofuran derivative from the endophytic fungus Botryosphaeria mamane PSU-M76.
Chem Pharm Bull (Tokyo). 2007 Sep;55(9):1404-5.
One new dihydrobenzofuran derivative, botryomaman (1), was isolated from the broth extract of the endophytic fungus Botryosphaeria mamane PSU-M76 along with six known compounds, 2,4-dimethoxy-6-pentylphenol, (R)-(-)-mellein, primin, cis-4-hydroxymellein, trans-4-hydroxymellein and 4,5-dihydroxy-2-hexenoic acid. The structures were assigned by spectroscopic methods. All compounds were tested for antibacterial activity against Staphylococcus aureus ATCC 25923 and methicillin-resistant S. aureus SK1. Primin showed the best activity against both strains with equal MIC values of 8 microg/ml. [Abstract/Link to Full Text]

Tiabou Tchinda A, Nahar Khan S, Fuendjiep V, Ngandeu F, Ngono Ngane A, Choudhary MI
Alpha-glucosidase inhibitors from Millettia conraui.
Chem Pharm Bull (Tokyo). 2007 Sep;55(9):1402-3.
A new geranylated isoflavone, 7-O-geranyl-6-methoxypseudobaptigenin (1) was isolated from the stem barks of Millettia conraui, along with known compounds 5-methoxydurmillone (2), conrauinone A (3), beta-amyrine (4), sitosterol (5), 3-O-beta-D-glucopyranosyl sitosterol (6) and n-docosanol (7). Compounds 1 and 4 showed a significant alpha-glucosidase inhibitory activity. The structures of the compounds were determined by analysis of their spectroscopic data. [Abstract/Link to Full Text]

Devkota KP, Lenta BN, Choudhary MI, Naz Q, Fekam FB, Rosenthal PJ, Sewald N
Cholinesterase inhibiting and antiplasmodial steroidal alkaloids from Sarcococca hookeriana.
Chem Pharm Bull (Tokyo). 2007 Sep;55(9):1397-401.
Bioguided phytochemical investigation of Sarcococca hookeriana with respect to the cholinesterase enzyme inhibitory assay yielded two new pregnane-type steriodal alkaloids hookerianamide H (1) and hookerianamide I (2), along with three known alkaloids N(a)-methylepipachysamine D (3), sarcovagine C (4) and dictyophlebine (5). Their structures were determined with the aid of extensive spectroscopic analysis. All compounds showed good inhibitory activities against the enzymes acetylcholinesterase (IC(50) 2.9-34.1 microM) and butyrylcholinesterase (IC(50) 0.3-3.6 microM). These compounds also showed moderate antiplasmodial activity (IC(50) 2.4-10.3 microM) against the Plasmodium falciparum chloroquine resistant W2 strain. [Abstract/Link to Full Text]

Yamauchi Y, Nakamura A, Kitai M, Hatanaka K, Kohno I, Tanimoto T
Improved sample pre-treatment for determination of caffeine in tea using a cartridge filled with polyvinylpolypyrroridone (PVPP).
Chem Pharm Bull (Tokyo). 2007 Sep;55(9):1393-6.
We have improved sample pre-treatment for the effective removal of polyphenols and simple analysis of caffeine in tea using a cartridge filled with polyvinylpolypyrroridone (PVPP). Nearly 100% of catechins were removed from the green tea sample and caffeine was completely recovered in the range of 98.2-101.3% by sample pre-treatment with a PVPP cartridge. Reproducibility of preparing PVPP pre-treatment cartridges was sufficient for quantitative analysis, because RSDs of analytical values for caffeine obtained by using three individual pre-treatment cartridges filled with 10-200 mg PVPP were 0.60-2.8%. The PVPP pre-treatment cartridge also removed polyphenols perfectly and recovered caffeine faultlessly from oolong and black tea samples. Comparison with the conventional method without sample pre-treatment indicated that the present pre-treatment method with a PVPP cartridge was useful for the simple and precise analysis of caffeine in green, oolong and black tea samples. [Abstract/Link to Full Text]

Cheng XL, Ma SC, Wei F, Wang GL, Xiao XY, Lin RC
A new sesquiterpene isolated from Lindera aggregata (SIMS) KOSTERM.
Chem Pharm Bull (Tokyo). 2007 Sep;55(9):1390-2.
A new sesquiterpene, neolindenenonelactone (1), was first isolated from the dried roots of Lindera aggregata (SIMS) KOSTERM., along with four known compounds, linderane (2), isolinderalactone (3), linderalactone (4), and 8-hydroxylindestenolide (5). Their chemical structures were elucidated using spectral analysis of fast atom bombardment mass spectroscopy, one-dimensional nuclear magnetic resonance spectroscopy and two-dimensional-nuclear magnetic resonance spectroscopy including (1)H-NMR, (13)C-NMR, distortionless enhancement by polarization transfer, heteronuclear multiple-bond coherence, and single-crystal X-ray diffraction techniques. [Abstract/Link to Full Text]

Yakura T, Yoshimoto Y, Ishida C
Dirhodium(II)-catalyzed C-H amination reaction of (S)-3-(tert-butyldimethylsilyloxy)-2-methylpropyl carbamate: a facile preparation of optically active monoprotected 2-amino-2-methyl-1,3-propanediol.
Chem Pharm Bull (Tokyo). 2007 Sep;55(9):1385-9.
Dirhodium(II)-catalyzed C-H amination reaction of (S)-3-(tert-butyldimethylsilyloxy)-2-methylpropyl carbamate, which was easily prepared from methyl (S)-2-methyl-3-hydroxypropanoate, proceeded more smoothly than those of their 2-(methoxycarbonyl)propyl derivative to give the corresponding oxazolidinone in excellent yield. The resulting oxazolidinone was converted efficiently into both (R)-monoprotected and (S)-monoprotected 2-amino-2-methyl-1,3-propanediols. [Abstract/Link to Full Text]

Rukachaisirikul V, Kaeobamrung J, Panwiriyarat W, Saitai P, Sukpondma Y, Phongpaichit S, Sakayaroj J
A new pyrone derivative from the endophytic fungus Penicillium paxilli PSU-A71.
Chem Pharm Bull (Tokyo). 2007 Sep;55(9):1383-4.
One new pyrone derivative, named penicillone (1), together with paxilline, pyrenocines A (2) and B (3) were isolated from the endophytic fungus Penicillium paxilli PSU-A71. The structures were elucidated by spectroscopic methods. Pyrenocine B (3) mildly inhibited the growth of Microsporum gypseum SH-MU-4 with a MIC value of 32 microg/ml. [Abstract/Link to Full Text]

Radi AE, Abd-Elghany N, Wahdan T
Electrochemical study of the antineoplastic agent etoposide at carbon paste electrode and its determination in spiked human serum by differential pulse voltammetry.
Chem Pharm Bull (Tokyo). 2007 Sep;55(9):1379-82.
The electrochemical oxidation of the antineoplastic agent etoposide was studied at carbon paste electrode in Britton-Robinson buffer solutions over the pH range 2.0-10.0 using cyclic, linear sweep and differential pulse voltammetry. Oxidation of the drug was effected in a single reversible, diffusion-controlled step within the pH range 2.0-4.0, a second oxidation process was produced above pH 4.0. Using differential pulse voltammetry (DPV), the drug yielded a well-defined voltammetric response in Britton-Robinson buffer, pH 3.0 at 0.500 V (vs. Ag/AgCl) on carbon paste electrode. This process could be used to determine etoposide concentrations in the range 2.5 x 10(-7) to 2.5 x 10(-5) M with a detection limit of 1.0 x 10(-7) M. The method was successfully applied to the determination of the drug in spiked human serum. [Abstract/Link to Full Text]

Lee I, Yoo JK, Na M, Min BS, Lee J, Yun BS, Jin W, Kim H, Youn U, Chen QC, Song KS, Seong YH, Bae K
Cytotoxicity of triterpenes isolated from Aceriphyllum rossii.
Chem Pharm Bull (Tokyo). 2007 Sep;55(9):1376-8.
Bioassay-guided fractionation of a MeOH extract of the whole plant of Aceriphyllum rossii (Saxifragaceae) led to the isolation of two new triterpenes, 3alpha,23-isopropylidenedioxyolean-12-en-27-oic acid (1) and 23-hydroxy-3-oxoolean-12-en-27-oic acid (2), together with six known triterpenes, 3-oxoolean-12-en-27-oic acid (3), 3alpha-hydroxyolean-12-en-27-oic acid (4), beta-peltoboykinolic acid (5), aceriphyllic acid A (6), oleanolic acid (7), and gypsogenic acid (8). The structures of these compounds were elucidated on the basis of physicochemical and spectroscopic analyses. These compounds were evaluated for in vitro cytotoxicity against the K562 and HL-60 cell lines. Olean-12-en-27-oic acid derivatives (1-6) exhibited considerable cytotoxicity against K562 and HL-60 cell lines with IC(50) values ranging from 12.2 to 28.7 microM and from 12.1 to 25.8 microM, respectively. [Abstract/Link to Full Text]

Sangwan RS, Chaurasiya ND, Lal P, Misra L, Uniyal GC, Tuli R, Sangwan NS
Withanolide A biogeneration in in vitro shoot cultures of ashwagandha (Withania somnifera DUNAL), a main medicinal plant in Ayurveda.
Chem Pharm Bull (Tokyo). 2007 Sep;55(9):1371-5.
Multiple shoot cultures of two experimental lines of Withania somnifera plants (RS-Selection-1 and RS-Selection-2) were established using nodal segments as explants. The hormonal combinations of benzyl adenine and kinetin not only influenced their morphogenetic response but also differentially modulated the level of biogeneration of withanolide A in the in vitro shoots of the two lines. Interestingly, withanolide-A, that was hardly detectable in the aerial parts of field-grown Withania somnifera (explant source), accumulated considerably in the in vitro shoot cultures of the plant. The productivity of withanolide A in the cultures varied considerably (ca. 10-fold, 0.014 to 0.14 mg per gram fresh weight) with the change in the hormone composition of the culture media as well as genotype used as source of the explant. The shoot culture of RS-Selection-1 raised at 1.00 ppm of BAP and 0.50 ppm of kinetin displayed the highest concentration of withanolide A in the green shoots of 0.238 g per 100 g dry weight tissue. This was a more analytical concentration keeping in view the isolation yields so far reported from the dried roots of the field-grown plant (ca. 0.015 g per 100 g dry weight), even if isolation losses are considered during purification. The enhanced de novo biogenesis of withanolide A in shoot cultures was corroborated with radiolabel incorporation studies using [2-(14)C] acetate as a precursor. Production of withaferin A was also found in the in vitro shoot cultures. As this compound is a predominant withanolide of native shoots as well and has been already reported to be accumulated in in vitro shoot cultures, its biogeneration observed in these shoot cultures is not discussed in detail. [Abstract/Link to Full Text]

Yamano Y, Fujita Y, Mizuguchi Y, Nakagawa K, Okano T, Ito M, Wada A
Synthesis of gamma-hydroxybutenolides applying crossed aldol condensation in the presence of a bulky lewis acid and their anti-tumor activity.
Chem Pharm Bull (Tokyo). 2007 Sep;55(9):1365-70.
An improved synthesis of gamma-hydroxybutenolides 1a-d was achieved via crossed aldol condensation between aldehydes 2a-d and the protected gamma-hydroxy-beta-methylbutenolides 3 or 4 using the bulky Lewis acid, aluminum tris(2,6-diphenylphenoxide) (ATPH). Using this same methodology, the gamma-hydroxybutenolides 17a-d having various heteroaromatic rings were synthesized and their anti-tumor activities were evaluated. [Abstract/Link to Full Text]

Ehara T, Tanikawa S, Ono M, Akita H
Synthesis of (R)-curcumene and (R)-xanthorrizol based on 1,2-Aryl migration via phenonium ion.
Chem Pharm Bull (Tokyo). 2007 Sep;55(9):1361-4.
Solvolysis reaction of methyl (4S,5S)-4-(4'-methoxyphenyl)-5-tosyloxy-2(E)-hexenoate 5 in water-saturated MeNO(2) gave the 1,2-migration product, (4S,5S)-5-hydroxy-4-(4'-methoxyphenyl)-2-(E)-hexenoate 6 (55% yield), which was converted to methyl (R)-(4'-methylphenyl)hexanoate 11 in 25% overall yield (5 steps). Treatment of (R)-11 with MeLi gave tertiary alcohol congener 12, which was subjected to dehydration to afford (R)-(-)-curcumene 1. An introduction of hydroxyl group at meta-position of the aromatic ring in (R)-11 was achieved based on consecutive treatment [1) selective iodination, 2) conversion of aryl iodide to aryl boronate, 3) conversion of aryl boronate to phenol]. Thus obtained phenol (R)-16 was treated with MeLi to give tertiary alcohol congener 17, which was subjected to dehydration to afford (R)-(-)-xanthorrizol 2. [Abstract/Link to Full Text]

Shaheen Siddiqui B, Zhymabekovna Karzhaubekova Z, Shahmanovna Burasheva G, Adaibaevna Sultanova N
Chemical constituents of the aerial parts of Kalidium foliatum.
Chem Pharm Bull (Tokyo). 2007 Sep;55(9):1356-60.
Studies on the chemical constituents of the aerial parts of Kalidium foliatum have led to the isolation of three new and one known compounds. The structures of new constituents have been elucidated through spectral studies including 2D-NMR experiments (HMQC, HMBC, COSY, NOESY and J-resolved) and MS/MS fragmentation using Q-TOF mass spectrometer equipped with an ESI source as kalidiumoside C (=3beta-hydroxy-29-methylmalonoxy-olean-12-en-23,28-dioic acid-23-methyl-28-beta-D-glucopyranosyl ester; 1), kalidiunin (=3beta,23,29-trihydroxy-olean-12-en-28-methyl-oate; 2) and kalidiumoside D (=3beta,23,29-trihydroxyolean-12-en-28-oic acid-beta-D-glucopyranosyl ester; 3). The known compound was identified as 3beta,23,29-trihydroxy-olean-12-en-28-oic acid 4) through comparison of its spectral data with those reported in literature. Acid hydrolysis of both 2 and 3 yielded the known compound 4 providing a conclusive evidence of the proposed structures. [Abstract/Link to Full Text]

Aragon PJ, Yapi AD, Pinguet F, Chezal JM, Teulade JC, Blache Y
Synthesis and biological evaluation of indoloquinolines and pyridocarbazoles: a new example of unexpected photoreduction accompanying photocyclization.
Chem Pharm Bull (Tokyo). 2007 Sep;55(9):1349-55.
Indoloquinoline alkaloid cryptolepine and pyridocarbazole alkaloid ellipticine are of great interest because in vitro and in vivo studies revealed their good cytotoxic properties. In order to obtain some biologically active analogs of these compounds, we developed a synthesis based on the photocyclization of tertiary N-substituted enaminones derived from 1,3-cyclohexandione and 3 or 6-aminoquinoline. The angular cyclized compounds thus obtained were tested in vitro on K 562 cells and A 2780 doxorubicin sensitive and resistant cells. All compounds were less effective than doxorubicin in sensitive cells but their activity wasn't decreased by MDR resistance. [Abstract/Link to Full Text]

Nakamura S, Sugimoto S, Matsuda H, Yoshikawa M
Medicinal flowers. XVII. New dammarane-type triterpene glycosides from flower buds of American ginseng, Panax quinquefolium L.
Chem Pharm Bull (Tokyo). 2007 Sep;55(9):1342-8.
Five new dammarane-type triterpene glycosides, floralquinquenosides A, B, C, D, and E, were isolated from the flower buds of American ginseng, Panax quinquefolium L., together with 18 known dammarane-type triterpene glycosides and 3 flavonoid glycosides. The structures of new floralquinquenosides were elucidated on the basis of chemical and physicochemical evidence. [Abstract/Link to Full Text]

Hasegawa Y, Fukuda T, Hagimori K, Tomoda H, Omura S
Tensyuic acids, new antibiotics produced by Aspergillus niger FKI-2342.
Chem Pharm Bull (Tokyo). 2007 Sep;55(9):1338-41.
Six new alkylitaconic acids, designated tensyuic acids A to F, were isolated from the culture broth of Aspergillus niger FKI-2342 by solvent extraction, silica gel column chromatography and HPLC. Their structures were elucidated by spectroscopic analysis including UV, NMR, and MS. They are all alkylitaconic acid derivatives. Only tesyuic acid C showed moderate antimicrobial activity against Bacillus subtilis. [Abstract/Link to Full Text]

El-Halawany AM, Chung MH, Ma CM, Komatsu K, Nishihara T, Hattori M
Anti-estrogenic activity of mansorins and mansonones from the heartwood of Mansonia gagei DRUMM.
Chem Pharm Bull (Tokyo). 2007 Sep;55(9):1332-7.
Through an anti-estrogenic bioassay-guided fractionation of the methanol extract of Mansonia gagei, three new coumarins, called mansorins I (1), II (2) and III (3) and a new naphthoquinone, mansonone I (4), were isolated. Their structures were determined based on their NMR data and CD spectroscopy. The anti-estrogenic activity of the fractions and the isolated compounds were investigated using a yeast two-hybrid assay method expressing estrogen receptors alpha (ERalpha) and beta (ERbeta). In addition, an ERalpha competitor screening system (ligand binding screen) was used to verify the binding affinities of the isolated compounds to the estrogen receptor. 1,2-Naphthoquinones (mansonones) showed more binding affinities to ER in both assay systems. All the tested compounds showed higher binding affinities to ERbeta than to ERalpha in the yeast two-hybrid assay. Mansonones F and S showed the most potent estrogen binding and estrogen antagonistic effects. [Abstract/Link to Full Text]

Recent Articles in The Journal of Experimental Medicine

Tadokoro Y, Ema H, Okano M, Li E, Nakauchi H
De novo DNA methyltransferase is essential for self-renewal, but not for differentiation, in hematopoietic stem cells.
J Exp Med. 2007 Apr 16;204(4):715-22.
DNA methylation is an epigenetic modification essential for development. The DNA methyltransferases Dnmt3a and Dnmt3b execute de novo DNA methylation in gastrulating embryos and differentiating germline cells. It has been assumed that these enzymes generally play a role in regulating cell differentiation. To test this hypothesis, we examined the role of Dnmt3a and Dnmt3b in adult stem cells. CD34(-/low), c-Kit(+), Sca-1(+), lineage marker(-) (CD34(-) KSL) cells, a fraction of mouse bone marrow cells highly enriched in hematopoietic stem cells (HSCs), expressed both Dnmt3a and Dnmt3b. Using retroviral Cre gene transduction, we conditionally disrupted Dnmt3a, Dnmt3b, or both Dnmt3a and Dnmt3b (Dnmt3a/Dnmt3b) in CD34(-) KSL cells purified from mice in which the functional domains of these genes are flanked by two loxP sites. We found that Dnmt3a and Dnmt3b function as de novo DNA methyltransferases during differentiation of hematopoietic cells. Unexpectedly, in vitro colony assays and in vivo transplantation assays showed that both myeloid and lymphoid lineage differentiation potentials were maintained in Dnmt3a-, Dnmt3b-, and Dnmt3a/Dnmt3b-deficient HSCs. However, Dnmt3a/Dnmt3b-deficient HSCs, but not Dnmt3a- or Dnmt3b-deficient HSCs, were incapable of long-term reconstitution in transplantation assays. These findings establish a critical role for DNA methylation by Dnmt3a and Dnmt3b in HSC self-renewal. [Abstract/Link to Full Text]

Masuda A, Nakamura A, Maeda T, Sakamoto Y, Takai T
Cis binding between inhibitory receptors and MHC class I can regulate mast cell activation.
J Exp Med. 2007 Apr 16;204(4):907-20.
Allergy is caused by immune effector cells, including mast cells and basophils. Cellular signaling that activates these effector cells is regulated by different inhibitory receptors on their surface. We show that human leukocyte immunoglobulin (Ig)-like receptor (LILR) B2 and its mouse orthologue, paired Ig-like receptor (PIR)-B, constitutively associate to major histocompatibility complex (MHC) class I on the same cell surface (in cis). The IgE-mediated effector responses were augmented in beta(2)-microglobulin (beta(2)m) and PIR-B-deficient mast cells. In addition, the increased cytokine production of beta(2)m-deficient mast cells was not affected by the co-culture with MHC class I-positive mast cells, showing that less cis interaction between PIR-B and MHC class I on mast cells led to the increased cytokine release. Thus, the constitutive cis binding between LILRB2 or PIR-B and MHC class I has an essential role in regulating allergic responses. [Abstract/Link to Full Text]

Bashyam H
Crossing barriers in transplantation.
J Exp Med. 2007 Mar 19;204(3):459.
In 1978, Jonathan Sprent and Robert Korngold proved that graft-versus-host disease (GVHD) is caused by donor T cells that attack the host's non-MHC antigens. T cell depletion of donor grafts has since become a staple of transplantation strategies to combat leukemia and other inherited blood disorders. [Abstract/Link to Full Text]

Henderson WR, Chi EY, Bollinger JG, Tien YT, Ye X, Castelli L, Rubtsov YP, Singer AG, Chiang GK, Nevalainen T, Rudensky AY, Gelb MH
Importance of group X-secreted phospholipase A2 in allergen-induced airway inflammation and remodeling in a mouse asthma model.
J Exp Med. 2007 Apr 16;204(4):865-77.
Arachidonic acid metabolites, the eicosanoids, are key mediators of allergen-induced airway inflammation and remodeling in asthma. The availability of free arachidonate in cells for subsequent eicosanoid biosynthesis is controlled by phospholipase A(2)s (PLA(2)s), most notably cytosolic PLA(2)-alpha. 10 secreted PLA(2)s (sPLA(2)s) have also been identified, but their function in eicosanoid generation is poorly understood. We investigated the role of group X sPLA(2) (sPLA(2)-X), the sPLA(2) with the highest in vitro cellular phospholipolysis activity, in acute and chronic mouse asthma models in vivo. The lungs of sPLA(2)-X(-/-) mice, compared with those of sPLA(2)-X(+/+) littermates, had significant reduction in ovalbumin-induced infiltration by CD4(+) and CD8(+) T cells and eosinophils, goblet cell metaplasia, smooth muscle cell layer thickening, subepithelial fibrosis, and levels of T helper type 2 cell cytokines and eicosanoids. These data direct attention to sPLA(2)-X as a novel therapeutic target for asthma. [Abstract/Link to Full Text]

Kuo TC, Shaffer AL, Haddad J, Choi YS, Staudt LM, Calame K
Repression of BCL-6 is required for the formation of human memory B cells in vitro.
J Exp Med. 2007 Apr 16;204(4):819-30.
Memory B cells provide rapid protection to previously encountered antigens; however, how these cells develop from germinal center B cells is not well understood. A previously described in vitro culture system using human tonsillar germinal center B cells was used to study the transcriptional changes that occur during differentiation of human memory B cells. Kinetic studies monitoring the expression levels of several known late B cell transcription factors revealed that BCL-6 is not expressed in memory B cells generated in vitro, and gene expression profiling studies confirmed that BCL-6 is not expressed in these memory B cells. Furthermore, ectopic expression of BCL-6 in human B cell cultures resulted in formation of fewer memory B cells. In addition, the expression profile of in vitro memory B cells showed a unique pattern that includes expression of genes encoding multiple costimulatory molecules and cytokine receptors, antiapoptotic proteins, T cell chemokines, and transcription factors. These studies establish new molecular criteria for defining the memory B cell stage in human B cells. [Abstract/Link to Full Text]

Loeser S, Loser K, Bijker MS, Rangachari M, van der Burg SH, Wada T, Beissert S, Melief CJ, Penninger JM
Spontaneous tumor rejection by cbl-b-deficient CD8+ T cells.
J Exp Med. 2007 Apr 16;204(4):879-91.
The concept of tumor surveillance implies that specific and nonspecific components of the immune system eliminate tumors in the early phase of malignancy. Understanding the biochemical mechanisms of tumor immunosurveillance is of paramount significance because it might allow one to specifically modulate spontaneous antitumor activity. We report that inactivation of the E3 ligase Casitas B cell lymphoma-b (Cbl-b) confers spontaneous in vivo rejection of tumor cells that express human papilloma virus antigens. Moreover, cbl-b(-/-) mice develop significantly fewer ultraviolet B (UVB)-induced skin malignancies and reject UVB-induced skin tumors. CD8(+) T cells were identified as key players in the spontaneous tumor rejection response. Loss of Cbl-b not only enhances antitumor reactivity of CD8(+) T cells but also occurs in the absence of CD4(+) T cells. Mechanistically, cbl-b(-/-) CD8(+) T cells are resistant to T regulatory cell-mediated suppression and exhibit enhanced activation and rapid tumor infiltration. Importantly, therapeutic transfer of naive cbl-b(-/-) CD8(+) T cells is sufficient to mediate rejection of established tumors. Even up to 1 yr after the first encounter with the tumor cells, cbl-b(-/-) mice carry an "anticancer memory." These data identify Cbl-b as a key signaling molecule that controls spontaneous antitumor activity of cytotoxic T cells in different cancer models. Inhibition of Cbl-b is a novel approach to stimulate long-lasting immunity against cancer. [Abstract/Link to Full Text]

Sagiv Y, Bai L, Wei DG, Agami R, Savage PB, Teyton L, Bendelac A
A distal effect of microsomal triglyceride transfer protein deficiency on the lysosomal recycling of CD1d.
J Exp Med. 2007 Apr 16;204(4):921-8.
Microsomal triglyceride transfer protein (MTP) is an endoplasmic reticulum (ER)-resident lipid transfer protein involved in the biosynthesis and lipid loading of apolipoprotein B. MTP was recently suggested to directly regulate the biosynthesis of the MHC I-like, lipid antigen presenting molecule CD1d, based on coprecipitation experiments and lipid loading assays. However, we found that the major impact of MTP deficiency occurred distal to the ER and Golgi compartments. Thus, although the rates of CD1d biosynthesis, glycosylation maturation, and internalization from the cell surface were preserved, the late but essential stage of recycling from lysosome to plasma membrane was profoundly impaired. Likewise, functional experiments indicated defects of CD1d-mediated lipid presentation in the lysosome but not in the secretory pathway. These intriguing findings suggest a novel, unexpected role of MTP at a late stage of CD1d trafficking in the lysosomal compartment. [Abstract/Link to Full Text]

Sun Z, Denton PW, Estes JD, Othieno FA, Wei BL, Wege AK, Melkus MW, Padgett-Thomas A, Zupancic M, Haase AT, Garcia JV
Intrarectal transmission, systemic infection, and CD4+ T cell depletion in humanized mice infected with HIV-1.
J Exp Med. 2007 Apr 16;204(4):705-14.
Intrarectal infection between men who have sex with men represents a predominant form of human immunodeficiency virus (HIV) transmission in developed countries. Currently there are no adequate small animal models that recapitulate intrarectal HIV transmission. Here we demonstrate that human lymphocytes generated in situ from hematopoietic stem cells reconstitute the gastrointestinal tract of humanized mice with human CD4(+) T cells rendering them susceptible to intrarectal HIV transmission. HIV infection after a single intrarectal inoculation results in systemic infection with depletion of CD4(+) T cells in gut-associated lymphoid tissue and other pathologic sequela that closely mimics those observed in HIV infected humans. This novel model provides the basis for the development and evaluation of novel approaches aimed at immune reconstitution of human gut-associated lymphoid tissue and for the development, testing, and implementation of microbicides to prevent intrarectal HIV-1 transmission. [Abstract/Link to Full Text]

Spisek R, Kukreja A, Chen LC, Matthews P, Mazumder A, Vesole D, Jagannath S, Zebroski HA, Simpson AJ, Ritter G, Durie B, Crowley J, Shaughnessy JD, Scanlan MJ, Gure AO, Barlogie B, Dhodapkar MV
Frequent and specific immunity to the embryonal stem cell-associated antigen SOX2 in patients with monoclonal gammopathy.
J Exp Med. 2007 Apr 16;204(4):831-40.
Specific targets of cellular immunity in human premalignancy are largely unknown. Monoclonal gammopathy of undetermined significance (MGUS) represents a precursor lesion to myeloma (MM). We show that antigenic targets of spontaneous immunity in MGUS differ from MM. MGUS patients frequently mount a humoral and cellular immune response against SOX2, a gene critical for self-renewal in embryonal stem cells. Intranuclear expression of SOX2 marks the clonogenic CD138(-) compartment in MGUS. SOX2 expression is also detected in a proportion of CD138(+) cells in MM patients. However, these patients lack anti-SOX2 immunity. Cellular immunity to SOX2 inhibits the clonogenic growth of MGUS cells in vitro. Detection of anti-SOX2 T cells predicts favorable clinical outcome in patients with asymptomatic plasmaproliferative disorders. Harnessing immunity to antigens expressed by tumor progenitor cells may be critical for prevention and therapy of human cancer. [Abstract/Link to Full Text]

Schrantz N, Sagiv Y, Liu Y, Savage PB, Bendelac A, Teyton L
The Niemann-Pick type C2 protein loads isoglobotrihexosylceramide onto CD1d molecules and contributes to the thymic selection of NKT cells.
J Exp Med. 2007 Apr 16;204(4):841-52.
The Niemann-Pick type C2 (NPC2) protein is a small, soluble, lysosomal protein important for cholesterol and sphingolipid transport in the lysosome. The immunological phenotype of NPC2-deficient mice was limited to an impaired thymic selection of Valpha14 natural killer T cells (NKT cells) and a subsequent reduction of NKT cells in the periphery. The remaining NKT cells failed to produce measurable quantities of interferon-gamma in vivo and in vitro after activation with alpha-galactosylceramide. In addition, thymocytes and splenocytes from NPC2-deficient mice were poor presenters of endogenous and exogenous lipids to CD1d-restricted Valpha14 hybridoma cells. Importantly, we determined that similar to saposins, recombinant NPC2 was able to unload lipids from and load lipids into CD1d. This transfer activity was associated with a dimeric form of NPC2, suggesting a unique mechanism of glycosphingolipid transfer by NPC2. Similar to saposin B, NPC2 dimers were able to load isoglobotrihexosylceramide (iGb3), the natural selecting ligand of NKT cells in the thymus, into CD1d. These observations strongly suggested that the phenotype observed in NPC2-deficient animals was directly linked to the efficiency of the loading of iGb3 into CD1d molecules expressed by thymocytes. This conclusion was supported by the rescue of endogenous and exogenous iGb3 presentation by recombinant NPC2. Thus, the loading of endogenous and exogenous lipids and glycolipids onto CD1d is dependent on various small, soluble lipid transfer proteins present in the lysosome. [Abstract/Link to Full Text]

Jaillon S, Peri G, Delneste Y, Fr�maux I, Doni A, Moalli F, Garlanda C, Romani L, Gascan H, Bellocchio S, Bozza S, Cassatella MA, Jeannin P, Mantovani A
The humoral pattern recognition receptor PTX3 is stored in neutrophil granules and localizes in extracellular traps.
J Exp Med. 2007 Apr 16;204(4):793-804.
The long pentraxin (PTX) 3 is produced by macrophages and myeloid dendritic cells in response to Toll-like receptor agonists and represents a nonredundant component of humoral innate immunity against selected pathogens. We report that, unexpectedly, PTX3 is stored in specific granules and undergoes release in response to microbial recognition and inflammatory signals. Released PTX3 can partially localize in neutrophil extracellular traps formed by extruded DNA. Eosinophils and basophils do not contain preformed PTX3. PTX3-deficient neutrophils have defective microbial recognition and phagocytosis, and PTX3 is nonredundant for neutrophil-mediated resistance against Aspergillus fumigatus. Thus, neutrophils serve as a reservoir, ready for rapid release, of the long PTX3, a key component of humoral innate immunity with opsonic activity. [Abstract/Link to Full Text]

Schleicher U, Liese J, Knippertz I, Kurzmann C, Hesse A, Heit A, Fischer JA, Weiss S, Kalinke U, Kunz S, Bogdan C
NK cell activation in visceral leishmaniasis requires TLR9, myeloid DCs, and IL-12, but is independent of plasmacytoid DCs.
J Exp Med. 2007 Apr 16;204(4):893-906.
Natural killer (NK) cells are sentinel components of the innate response to pathogens, but the cell types, pathogen recognition receptors, and cytokines required for their activation in vivo are poorly defined. Here, we investigated the role of plasmacytoid dendritic cells (pDCs), myeloid DCs (mDCs), Toll-like receptors (TLRs), and of NK cell stimulatory cytokines for the induction of an NK cell response to the protozoan parasite Leishmania infantum. In vitro, pDCs did not endocytose Leishmania promastigotes but nevertheless released interferon (IFN)-alpha/beta and interleukin (IL)-12 in a TLR9-dependent manner. mDCs rapidly internalized Leishmania and, in the presence of TLR9, produced IL-12, but not IFN-alpha/beta. Depletion of pDCs did not impair the activation of NK cells in L. infantum-infected mice. In contrast, L. infantum-induced NK cell cytotoxicity and IFN-gamma production were abolished in mDC-depleted mice. The same phenotype was observed in TLR9(-/-) mice, which lacked IL-12 expression by mDCs, and in IL-12(-/-) mice, whereas IFN-alpha/beta receptor(-/-) mice showed only a minor reduction of NK cell IFN-gamma expression. This study provides the first direct evidence that mDCs are essential for eliciting NK cell cytotoxicity and IFN-gamma release in vivo and demonstrates that TLR9, mDCs, and IL-12 are functionally linked to the activation of NK cells in visceral leishmaniasis. [Abstract/Link to Full Text]

Beltman JB, Mar�e AF, Lynch JN, Miller MJ, de Boer RJ
Lymph node topology dictates T cell migration behavior.
J Exp Med. 2007 Apr 16;204(4):771-80.
Adaptive immunity is initiated by T cell recognition of foreign peptides presented on dendritic cells (DCs) by major histocompatibility molecules. These interactions take place in secondary lymphoid tissues, such as lymph nodes (LNs) and spleen, and hence the anatomical structure of these tissues plays a crucial role in the development of immune responses. Two-photon microscopy (2PM) imaging in LNs suggests that T cells walk in a consistent direction for several minutes, pause briefly with a regular period, and then take off in a new, random direction. Here, we construct a spatially explicit model of T cell and DC migration in LNs and show that all dynamical properties of T cells could be a consequence of the densely packed LN environment. By means of 2PM experiments, we confirm that the large velocity fluctuations of T cells are indeed environmentally determined rather than resulting from an intrinsic motility program. Our simulations further predict that T cells self-organize into microscopically small, highly dynamic streams. We present experimental evidence for the presence of such turbulent streams in LNs. Finally, the model allows us to estimate the scanning rates of DCs (2,000 different T cells per hour) and T cells (100 different DCs per hour). [Abstract/Link to Full Text]

Nyl�n S, Maurya R, Eidsmo L, Manandhar KD, Sundar S, Sacks D
Splenic accumulation of IL-10 mRNA in T cells distinct from CD4+CD25+ (Foxp3) regulatory T cells in human visceral leishmaniasis.
J Exp Med. 2007 Apr 16;204(4):805-17.
Visceral leishmaniasis (VL) is a life-threatening disease characterized by uncontrolled parasitization of the spleen, liver, and bone marrow. Interleukin (IL)-10 has been implicated in the suppression of host immunity in human VL based on the elevated levels of IL-10 observed in plasma and lesional tissue, and its role in preventing clearance of Leishmania donovani in murine models of VL. The aim of this study was to identify the cellular source of IL-10 in human VL and determine if CD4(+)CD25(+) (Foxp3(high)) regulatory T (T reg) cells are associated with active disease. We analyzed surface marker and gene expression in peripheral blood mononuclear cells and splenic aspirates from Indian VL patients before and 3-4 wk after treatment with Amphotericin B. The results did not point to an important role for natural CD4(+)CD25(+) (Foxp3(high)) T reg cells in human VL. They did not accumulate in and were not a major source of IL-10 in the spleen, and their removal did not rescue antigen-specific interferon gamma responses. In contrast, splenic T cells depleted of CD25(+) cells expressed the highest levels of IL-10 mRNA and were the predominant lymphocyte population in the VL spleen. The elevated levels of IL-10 in VL plasma significantly enhanced the growth of L. donovani amastigotes in human macrophages. The data implicate IL-10-producing CD25(-)Foxp3(-) T cells in the pathogenesis of human VL. [Abstract/Link to Full Text]

Liu CH, Machado FS, Guo R, Nichols KE, Burks AW, Aliberti JC, Zhong XP
Diacylglycerol kinase zeta regulates microbial recognition and host resistance to Toxoplasma gondii.
J Exp Med. 2007 Apr 16;204(4):781-92.
Mammalian Toll-like receptors (TLRs) recognize microbial pathogen-associated molecular patterns and are critical for innate immunity against microbial infection. Diacylglycerol (DAG) kinases (DGKs) regulate the intracellular levels of two important second messengers involved in signaling from many surface receptors by converting DAG to phosphatidic acid (PA). We demonstrate that the zeta isoform of the DGK family (DGKzeta) is expressed in macrophages (Mphi) and dendritic cells. DGKzeta deficiency results in impaired interleukin (IL) 12 and tumor necrosis factor alpha production following TLR stimulation in vitro and in vivo, increased resistance to endotoxin shock, and enhanced susceptibility to Toxoplasma gondii infection. We further show that DGKzeta negatively controls the phosphatidylinositol 3-kinase (PI3K)-Akt pathway and that inhibition of PI3K activity or treatment with PA can restore lipopolysaccharide-induced IL-12 production by DGKzeta-deficient Mphi. Collectively, our data provide the first genetic evidence that an enzyme involved in DAG/PA metabolism plays an important role in innate immunity and indicate that DGKzeta promotes TLR responses via a pathway involving inhibition of PI3K. [Abstract/Link to Full Text]

Kocks JR, Davalos-Misslitz AC, Hintzen G, Ohl L, F�rster R
Regulatory T cells interfere with the development of bronchus-associated lymphoid tissue.
J Exp Med. 2007 Apr 16;204(4):723-34.
Presence and extent of bronchus-associated lymphoid tissue (BALT) is subject to considerable variations between species and is only occasionally observed in lungs of mice. Here we demonstrate that mice deficient for the chemokine receptor CCR7 regularly develop highly organized BALT. These structures were not present at birth but were detectable from day 5 onwards. Analyzing CCR7(-/-)/wild-type bone marrow chimeras, we demonstrate that the development of BALT is caused by alterations of the hematopoietic system in CCR7-deficient mice. These observations together with the finding that CCR7-deficient mice possess dramatically reduced numbers of regulatory T cells (T reg cells) in the lung-draining bronchial lymph node suggest that BALT formation might be caused by disabled in situ function of T reg cells. Indeed, although adoptive transfer of wild-type T reg cells to CCR7-deficient recipients resulted in a profound reduction of BALT formation, neither naive wild-type T cells nor T reg cells from CCR7(-/-) donors impair BALT generation. Furthermore, we provide evidence that CCR7-deficient T reg cells, although strongly impaired in homing to peripheral lymph nodes, are fully effective in vitro. Thus our data reveal a CCR7-dependent homing of T reg cells to peripheral lymph nodes in conjunction with a role for these cells in controlling BALT formation. [Abstract/Link to Full Text]

Schneider MA, Meingassner JG, Lipp M, Moore HD, Rot A
CCR7 is required for the in vivo function of CD4+ CD25+ regulatory T cells.
J Exp Med. 2007 Apr 16;204(4):735-45.
CCR7-mediated migration of naive T cells into the secondary lymphoid organs is a prerequisite for their encounter with mature dendritic cells, the productive presentation of cognate antigen, and consequent T cell proliferation and effector differentiation. Therefore, CCR7 was suggested to play an important role in the initiation of adaptive immune responses. In this study, we show that primary immunity can also develop in the absence of CCR7. Moreover, CCR7-deficient knockout (KO) mice display augmented immune responses. Our data cumulatively suggest that enhanced immunity in CCR7 KO mice is caused by the defective lymph node (LN) positioning of FoxP3(+) CD4(+) CD25(+) regulatory T cells (T reg cells) and the consequent impediment of their function. The FoxP3(+) T reg cells express CCR7 and, after their adoptive transfer, migrate into the LNs of wild-type mice. Here, they proliferate in situ upon antigen stimulation and inhibit the generation of antigen-specific T cells. Conversely, transferred CCR7-deficient T reg cells fail to migrate into the LNs and suppress antigen-induced T cell responses. The transfer of combinations of naive and T reg cells from wild-type and CCR7 KO mice into syngeneic severe combined immunodeficient mice directly demonstrates that CCR7-deficient T reg cells are less effective than their wild-type counterparts in preventing the development of inflammatory bowel disease. [Abstract/Link to Full Text]

Bashyam H
Th1/Th2 cross-regulation and the discovery of IL-10.
J Exp Med. 2007 Feb 19;204(2):237.
In the late 1980s, Tim Mosmann and colleagues isolated functionally distinct T helper (Th)-1 and Th2 clones, and provided evidence that these two subsets were mutually inhibitory. Knowledge of the inhibition led to the discovery that Th2 cells make IL-10 to suppress Th1 cells. [Abstract/Link to Full Text]

Liston A, Farr AG, Chen Z, Benoist C, Mathis D, Manley NR, Rudensky AY
Lack of Foxp3 function and expression in the thymic epithelium.
J Exp Med. 2007 Mar 19;204(3):475-80.
Foxp3 is essential for the commitment of differentiating thymocytes to the regulatory CD4(+) T (T reg) cell lineage. In humans and mice with a genetic Foxp3 deficiency, absence of this critical T reg cell population was suggested to be responsible for the severe autoimmune lesions. Recently, it has been proposed that in addition to T reg cells, Foxp3 is also expressed in thymic epithelial cells where it is involved in regulation of early thymocyte differentiation and is required to prevent autoimmunity. Here, we used genetic tools to demonstrate that the thymic epithelium does not express Foxp3. Furthermore, we formally showed that genetic abatement of Foxp3 in the hematopoietic compartment, i.e. in T cells, is both necessary and sufficient to induce the autoimmune lesions associated with Foxp3 loss. In contrast, deletion of a conditional Foxp3 allele in thymic epithelial cells did not result in detectable changes in thymocyte differentiation or pathology. Therefore, in mice the only known role for Foxp3 remains promotion of T reg cell differentiation within the T cell lineage, whereas there is no role for Foxp3 in thymic epithelial cells. [Abstract/Link to Full Text]

Van Etten RA
Oncogenic signaling: new insights and controversies from chronic myeloid leukemia.
J Exp Med. 2007 Mar 19;204(3):461-5.
Chronic myeloid leukemia (CML), which is caused by the BCR-ABL fusion tyrosine kinase, is one of the most intensively studied human cancers. ABL kinase inhibitors have been spectacularly successful in treating CML, but disease persistence and acquired drug resistance can prevent eradication and cure of the leukemia. The development of better therapies will depend on a full understanding of signaling pathways in CML, facilitated by model studies using mutant mice. [Abstract/Link to Full Text]

Middleton MK, Zukas AM, Rubinstein T, Jacob M, Zhu P, Zhao L, Blair I, Pur� E
Identification of 12/15-lipoxygenase as a suppressor of myeloproliferative disease.
J Exp Med. 2006 Oct 30;203(11):2529-40.
Though Abl inhibitors are often successful therapies for the initial stages of chronic myelogenous leukemia (CML), refractory cases highlight the need for novel molecular insights. We demonstrate that mice deficient in the enzyme 12/15-lipoxygenase (12/15-LO) develop a myeloproliferative disorder (MPD) that progresses to transplantable leukemia. Although not associated with dysregulation of Abl, cells isolated from chronic stage 12/15-LO-deficient (Alox15) mice exhibit increased activation of the phosphatidylinositol 3-kinase (PI3-K) pathway, as indicated by enhanced phosphorylation of Akt. Furthermore, the transcription factor interferon consensus sequence binding protein (ICSBP) is hyperphosphorylated and displays decreased nuclear accumulation, translating into increased levels of expression of the oncoprotein Bcl-2. The ICSBP defect, exaggerated levels of Bcl-2, and prolonged leukemic cell survival associated with chronic stage Alox15 MPD are all reversible upon treatment with a PI3-K inhibitor. Remarkably, the evolution of Alox15 MPD to leukemia is associated with additional regulation of ICSBP on an RNA level, highlighting the potential usefulness of the Alox15 model for understanding the transition of CML to crisis. Finally, 12/15-LO expression suppresses the growth of a human CML-derived cell line. These data identify 12/15-LO as an important suppressor of MPD via its role as a critical upstream effector in the regulation of PI3-K-dependent ICSBP phosphorylation. [Abstract/Link to Full Text]

Di Bartolo V, Montagne B, Salek M, Jungwirth B, Carrette F, Fourtane J, Sol-Foulon N, Michel F, Schwartz O, Lehmann WD, Acuto O
A novel pathway down-modulating T cell activation involves HPK-1-dependent recruitment of 14-3-3 proteins on SLP-76.
J Exp Med. 2007 Mar 19;204(3):681-91.
The SH2 domain-containing leukocyte protein of 76 kD (SLP-76) is a pivotal element of the signaling machinery controlling T cell receptor (TCR)-mediated activation. Here, we identify 14-3-3epsilon and zeta proteins as SLP-76 binding partners. This interaction was induced by TCR ligation and required phosphorylation of SLP-76 at serine 376. Ribonucleic acid interference and in vitro phosphorylation experiments showed that serine 376 is the target of the hematopoietic progenitor kinase 1 (HPK-1). Interestingly, either S376A mutation or HPK-1 knockdown resulted in increased TCR-induced tyrosine phosphorylation of SLP-76 and phospholipase C-gamma1. Moreover, an SLP-76-S376A mutant induced higher interleukin 2 gene transcription than wild-type SLP-76. These data reveal a novel negative feedback loop involving HPK-1-dependent serine phosphorylation of SLP-76 and 14-3-3 protein recruitment, which tunes T cell activation. [Abstract/Link to Full Text]

Lenz G, Nagel I, Siebert R, Roschke AV, Sanger W, Wright GW, Dave SS, Tan B, Zhao H, Rosenwald A, Muller-Hermelink HK, Gascoyne RD, Campo E, Jaffe ES, Smeland EB, Fisher RI, Kuehl WM, Chan WC, Staudt LM
Aberrant immunoglobulin class switch recombination and switch translocations in activated B cell-like diffuse large B cell lymphoma.
J Exp Med. 2007 Mar 19;204(3):633-43.
To elucidate the mechanisms underlying chromosomal translocations in diffuse large B cell lymphoma (DLBCL), we investigated the nature and extent of immunoglobulin class switch recombination (CSR) in these tumors. We used Southern blotting to detect legitimate and illegitimate CSR events in tumor samples of the activated B cell-like (ABC), germinal center B cell-like (GCB), and primary mediastinal B cell lymphoma (PMBL) subgroups of DLBCL. The frequency of legitimate CSR was lower in ABC DLBCL than in GCB DLBCL and PMBL. In contrast, ABC DLBCL had a higher frequency of internal deletions within the switch mu (Smu) region compared with GCB DLBCL and PMBL. ABC DLBCLs also had frequent deletions within Sgamma and other illegitimate switch recombinations. Sequence analysis revealed ongoing Smu deletions within ABC DLBCL tumor clones, which were accompanied by ongoing duplications and activation-induced cytidine deaminase-dependent somatic mutations. Unexpectedly, short fragments derived from multiple chromosomes were interspersed within Smu in one case. These findings suggest that ABC DLBCLs have abnormalities in the regulation of CSR that could predispose to chromosomal translocations. Accordingly, aberrant switch recombination was responsible for translocations in ABC DLBCLs involving BCL6, MYC, and a novel translocation partner, SPIB. [Abstract/Link to Full Text]

Perrigoue JG, Li J, Zaph C, Goldschmidt M, Scott P, de Sauvage FJ, Pearce EJ, Ghilardi N, Artis D
IL-31-IL-31R interactions negatively regulate type 2 inflammation in the lung.
J Exp Med. 2007 Mar 19;204(3):481-7.
Interleukin (IL) 31Ralpha (glycoprotein 130-like monocyte receptor and glycoprotein 130-like receptor) heterodimerizes with oncostatin M receptor beta to bind IL-31, a cytokine expressed preferentially by CD4(+) T helper type 2 (Th2) cells. However, the functions of IL-31-IL-31R signaling in immune regulation remain unknown. Here, we identify a novel role for IL-31R in limiting type 2 inflammation in the lung. After intravenous injection of Schistosoma mansoni eggs, IL-31Ralpha(-/-) mice developed severe pulmonary inflammation, characterized by an increase in the area of granulomatous inflammation, increased numbers of resistin-like molecule alpha(+) cells, and enhanced collagen deposition compared to WT counterparts. In vitro, macrophages generated from IL-31Ralpha(-/-) mice promoted enhanced ovalbumin-specific CD4(+) T cell proliferation and purified naive CD4(+) T cells from IL-31Ralpha(-/-) mice exhibited enhanced proliferation and expression of Th2 cytokines, identifying a T cell- and macrophage-intrinsic regulatory function for IL-31R signaling. In contrast, the generation of CD4(+) T cell-mediated Th1 responses were normal in IL-31Ralpha(-/-) mice, suggesting that the regulatory role of IL-31R signaling is limited to type 2 responses. Together, these data implicate IL-31R signaling as a novel negative regulatory pathway that specifically limits type 2 inflammation. [Abstract/Link to Full Text]

Dunn C, Brunetto M, Reynolds G, Christophides T, Kennedy PT, Lampertico P, Das A, Lopes AR, Borrow P, Williams K, Humphreys E, Afford S, Adams DH, Bertoletti A, Maini MK
Cytokines induced during chronic hepatitis B virus infection promote a pathway for NK cell-mediated liver damage.
J Exp Med. 2007 Mar 19;204(3):667-80.
Hepatitis B virus (HBV) causes chronic infection in more than 350 million people worldwide. It replicates in hepatocytes but is non-cytopathic; liver damage is thought to be immune mediated. Here, we investigated the role of innate immune responses in mediating liver damage in patients with chronic HBV infection. Longitudinal analysis revealed a temporal correlation between flares of liver inflammation and fluctuations in interleukin (IL)-8, interferon (IFN)-alpha, and natural killer (NK) cell expression of tumor necrosis factor-related apoptosis-inducing ligand (TRAIL) directly ex vivo. A cross-sectional study confirmed these findings in patients with HBV-related liver inflammation compared with healthy carriers. Activated, TRAIL-expressing NK cells were further enriched in the liver of patients with chronic HBV infection, while their hepatocytes expressed increased levels of a TRAIL death-inducing receptor. IFN-alpha concentrations found in patients were capable of activating NK cells to induce TRAIL-mediated hepatocyte apoptosis in vitro. The pathogenic potential of this pathway could be further enhanced by the ability of the IFN-alpha/IL-8 combination to dysregulate the balance of death-inducing and regulatory TRAIL receptors expressed on hepatocytes. We conclude that NK cells may contribute to liver inflammation by TRAIL-mediated death of hepatocytes and demonstrate that this non-antigen-specific mechanism can be switched on by cytokines produced during active HBV infection. [Abstract/Link to Full Text]

Karlsson G, Blank U, Moody JL, Ehinger M, Singbrant S, Deng CX, Karlsson S
Smad4 is critical for self-renewal of hematopoietic stem cells.
J Exp Med. 2007 Mar 19;204(3):467-74.
Members of the transforming growth factor beta (TGF-beta) superfamily of growth factors have been shown to regulate the in vitro proliferation and maintenance of hematopoietic stem cells (HSCs). Working at a common level of convergence for all TGF-beta superfamily signals, Smad4 is key in orchestrating these effects. The role of Smad4 in HSC function has remained elusive because of the early embryonic lethality of the conventional knockout. We clarify its role by using an inducible model of Smad4 deletion coupled with transplantation experiments. Remarkably, systemic induction of Smad4 deletion through activation of MxCre was incompatible with survival 4 wk after induction because of anemia and histopathological changes in the colonic mucosa. Isolation of Smad4 deletion to the hematopoietic system via several transplantation approaches demonstrated a role for Smad4 in the maintenance of HSC self-renewal and reconstituting capacity, leaving homing potential, viability, and differentiation intact. Furthermore, the observed down-regulation of notch1 and c-myc in Smad4(-/-) primitive cells places Smad4 within a network of genes involved in the regulation HSC renewal. [Abstract/Link to Full Text]

Jiang Y, Reynolds C, Xiao C, Feng W, Zhou Z, Rodriguez W, Tyagi SC, Eaton JW, Saari JT, Kang YJ
Dietary copper supplementation reverses hypertrophic cardiomyopathy induced by chronic pressure overload in mice.
J Exp Med. 2007 Mar 19;204(3):657-66.
Sustained pressure overload causes cardiac hypertrophy and the transition to heart failure. We show here that dietary supplementation with physiologically relevant levels of copper (Cu) reverses preestablished hypertrophic cardiomyopathy caused by pressure overload induced by ascending aortic constriction in a mouse model. The reversal occurs in the continued presence of pressure overload. Sustained pressure overload leads to decreases in cardiac Cu and vascular endothelial growth factor (VEGF) levels along with suppression of myocardial angiogenesis. Cu supplementation replenishes cardiac Cu, increases VEGF, and promotes angiogenesis. Systemic administration of anti-VEGF antibody blunts Cu regression of hypertrophic cardiomyopathy. In cultured human cardiomyocytes, Cu chelation blocks insulin-like growth factor (IGF)-1- or Cu-stimulated VEGF expression, which is relieved by addition of excess Cu. Both IGF-1 and Cu activate hypoxia-inducible factor (HIF)-1alpha and HIF-1alpha gene silencing blocks IGF-1- or Cu-stimulated VEGF expression. HIF-1alpha coimmunoprecipitates with a Cu chaperone for superoxide dismutase-1 (CCS), and gene silencing of CCS, but not superoxide dismutase-1, prevents IGF-1- or Cu-induced HIF-1alpha activation and VEGF expression. Therefore, dietary Cu supplementation improves the condition of hypertrophic cardiomyopathy at least in part through CCS-mediated HIF-1alpha activation of VEGF expression and angiogenesis. [Abstract/Link to Full Text]

Adams RA, Bauer J, Flick MJ, Sikorski SL, Nuriel T, Lassmann H, Degen JL, Akassoglou K
The fibrin-derived gamma377-395 peptide inhibits microglia activation and suppresses relapsing paralysis in central nervous system autoimmune disease.
J Exp Med. 2007 Mar 19;204(3):571-82.
Perivascular microglia activation is a hallmark of inflammatory demyelination in multiple sclerosis (MS), but the mechanisms underlying microglia activation and specific strategies to attenuate their activation remain elusive. Here, we identify fibrinogen as a novel regulator of microglia activation and show that targeting of the interaction of fibrinogen with the microglia integrin receptor Mac-1 (alpha(M)beta(2), CD11b/CD18) is sufficient to suppress experimental autoimmune encephalomyelitis in mice that retain full coagulation function. We show that fibrinogen, which is deposited perivascularly in MS plaques, signals through Mac-1 and induces the differentiation of microglia to phagocytes via activation of Akt and Rho. Genetic disruption of fibrinogen-Mac-1 interaction in fibrinogen-gamma(390-396A) knock-in mice or pharmacologically impeding fibrinogen-Mac-1 interaction through intranasal delivery of a fibrinogen-derived inhibitory peptide (gamma(377-395)) attenuates microglia activation and suppresses relapsing paralysis. Because blocking fibrinogen-Mac-1 interactions affects the proinflammatory but not the procoagulant properties of fibrinogen, targeting the gamma(377-395) fibrinogen epitope could represent a potential therapeutic strategy for MS and other neuroinflammatory diseases associated with blood-brain barrier disruption and microglia activation. [Abstract/Link to Full Text]

Deshane J, Chen S, Caballero S, Grochot-Przeczek A, Was H, Li Calzi S, Lach R, Hock TD, Chen B, Hill-Kapturczak N, Siegal GP, Dulak J, Jozkowicz A, Grant MB, Agarwal A
Stromal cell-derived factor 1 promotes angiogenesis via a heme oxygenase 1-dependent mechanism.
J Exp Med. 2007 Mar 19;204(3):605-18.
Stromal cell-derived factor 1 (SDF-1) plays a major role in the migration, recruitment, and retention of endothelial progenitor cells to sites of ischemic injury and contributes to neovascularization. We provide direct evidence demonstrating an important role for heme oxygenase 1 (HO-1) in mediating the proangiogenic effects of SDF-1. Nanomolar concentrations of SDF-1 induced HO-1 in endothelial cells through a protein kinase C zeta-dependent and vascular endothelial growth factor-independent mechanism. SDF-1-induced endothelial tube formation and migration was impaired in HO-1-deficient cells. Aortic rings from HO-1(-/-) mice were unable to form capillary sprouts in response to SDF-1, a defect reversed by CO, a byproduct of the HO-1 reaction. Phosphorylation of vasodilator-stimulated phosphoprotein was impaired in HO-1(-/-) cells, an event that was restored by CO. The functional significance of HO-1 in the proangiogenic effects of SDF-1 was confirmed in Matrigel plug, wound healing, and retinal ischemia models in vivo. The absence of HO-1 was associated with impaired wound healing. Intravitreal adoptive transfer of HO-1-deficient endothelial precursors showed defective homing and reendothelialization of the retinal vasculature compared with HO-1 wild-type cells following ischemia. These findings demonstrate a mechanistic role for HO-1 in SDF-1-mediated angiogenesis and provide new avenues for therapeutic approaches in vascular repair. [Abstract/Link to Full Text]

Osborne LC, Dhanji S, Snow JW, Priatel JJ, Ma MC, Miners MJ, Teh HS, Goldsmith MA, Abraham N
Impaired CD8 T cell memory and CD4 T cell primary responses in IL-7R alpha mutant mice.
J Exp Med. 2007 Mar 19;204(3):619-31.
Loss of interleukin (IL)-7 or the IL-7 receptor alpha (IL-7Ralpha, CD127) results in severe immunodeficiencies in mice and humans. To more precisely identify signals governing IL-7 function in vivo, we have disrupted the IL-7Ralpha Y449XXM motif in mice by knock-in mutagenesis (IL-7Ralpha(449F)). Thymic precursors were reduced in number in IL-7Ralpha(449F) mice, but in marked contrast to IL-7Ralpha(-/-) knockout mice, thymocytes and peripheral T cells developed normally. Strikingly, Listeria infection revealed that CD4 and CD8 T cells had different requirements for IL-7Ralpha signals. CD4 T cells failed to mount a primary response, but despite normal CD8 primary responses, maintenance of CD8 memory was impaired in IL-7Ralpha(449F) mice. Furthermore, we show that Bcl-2 is IL-7Ralpha Y449 independent and insufficient for IL-7-mediated maintenance of CD8 memory. [Abstract/Link to Full Text]

Yang CS, Lee DS, Song CH, An SJ, Li S, Kim JM, Kim CS, Yoo DG, Jeon BH, Yang HY, Lee TH, Lee ZW, El-Benna J, Yu DY, Jo EK
Roles of peroxiredoxin II in the regulation of proinflammatory responses to LPS and protection against endotoxin-induced lethal shock.
J Exp Med. 2007 Mar 19;204(3):583-94.
Mammalian 2-Cys peroxiredoxin II (Prx II) is a cellular peroxidase that eliminates endogenous H(2)O(2). The involvement of Prx II in the regulation of lipopolysaccharide (LPS) signaling is poorly understood. In this report, we show that LPS induces substantially enhanced inflammatory events, which include the signaling molecules nuclear factor kappaB and mitogen-activated protein kinase (MAPK), in Prx II-deficient macrophages. This effect of LPS was mediated by the robust up-regulation of the reactive oxygen species (ROS)-generating nicotinamide adenine dinucleotide phosphate (NADPH) oxidases and the phosphorylation of p47(phox). Furthermore, challenge with LPS induced greater sensitivity to LPS-induced lethal shock in Prx II-deficient mice than in wild-type mice. Intravenous injection of Prx II-deficient mice with the adenovirus-encoding Prx II gene significantly rescued mice from LPS-induced lethal shock as compared with the injection of a control virus. The administration of catalase mimicked the reversal effects of Prx II on LPS-induced inflammatory responses in Prx II-deficient cells, which suggests that intracellular H(2)O(2) is attributable, at least in part, to the enhanced sensitivity to LPS. These results indicate that Prx II is an essential negative regulator of LPS-induced inflammatory signaling through modulation of ROS synthesis via NADPH oxidase activities and, therefore, is crucial for the prevention of excessive host responses to microbial products. [Abstract/Link to Full Text]

Zhu J, Koelle DM, Cao J, Vazquez J, Huang ML, Hladik F, Wald A, Corey L
Virus-specific CD8+ T cells accumulate near sensory nerve endings in genital skin during subclinical HSV-2 reactivation.
J Exp Med. 2007 Mar 19;204(3):595-603.
Cytotoxic CD8(+) T cells play a critical role in controlling herpes simplex virus (HSV) infection and reactivation. However, little is known about the spatiotemporal dynamics of CD8(+) T cells during HSV lesion evolution or about their involvement in immune surveillance after lesion resolution. Using quantum dot-conjugated peptide-major histocompatibility complex multimers, we investigated the in vivo localization of HSV-2-specific CD8(+) T cells in sequential biopsies of human genital skin during acute, resolving, and healed stages of HSV-2 reactivation. Our studies revealed that functionally active CD8(+) T cells selectively infiltrated to the site of viral reactivation. After lesion healing in concert with complete reepithelialization and loss of HSV DNA from skin biopsies, HSV-2-specific CD8(+) T cells persisted for more than two months at the dermal-epidermal junction, adjacent to peripheral nerve endings. In two out of the six sequentially studied individuals, HSV-2 DNA reappeared in clinically and histologically normal-appearing skin. Detection of viral DNA was accompanied by increased numbers of both HSV-specific and total CD8(+) T cells in the dermis. These findings indicate that the frequency and clinical course of HSV-2 reactivation in humans is influenced by virus-specific CD8(+) T cells that persist in peripheral mucosa and genital skin after resolution of herpes lesions. [Abstract/Link to Full Text]