• Don't forget to check out Neurotransmitter.net's research index for a list of dozens of other resources created by Shawn Thomas.
• The articles are retrieved from PubMed Central and PubMed on a daily basis.
  
• Free full text articles are also available for the following subjects: biology, molecular and cellular biology, neuroscience, genetics and proteomics, psychiatry, pharmacology, endocrinology, microbiology, cancer, informatics, and miscellaneous.
  
• You can jump directly to articles from Biomedical Engineering Online, Journal of Biomedicine & Biotechnology, BMC Biotechnology, Journal of Nanobiotechnology, BMC Medical Imaging, and Biomagnetic Research and Technology.
  
• You can view other articles from these journals as well: skip 0, skip 60, skip 90, or skip 120 of the most recent articles.
  
• Confused by the terminology? Try searching The On-Line Medical Dictionary (OMD).

Web www.neurotransmitter.net

---

Recent Articles in Biomedical Engineering Online

---

Dash RK, Dibella JA, Cabrera ME
A computational model of skeletal muscle metabolism linking cellular adaptations induced by altered loading states to metabolic responses during exercise.
Biomed Eng Online. 2007;614.
BACKGROUND: The alterations in skeletal muscle structure and function after prolonged periods of unloading are initiated by the chronic lack of mechanical stimulus of sufficient intensity, which is the result of a series of biochemical and metabolic interactions spanning from cellular to tissue/organ level. Reduced activation of skeletal muscle alters the gene expression of myosin heavy chain isoforms to meet the functional demands of reduced mechanical load, which results in muscle atrophy and reduced capacity to process fatty acids. In contrast, chronic loading results in the opposite pattern of adaptations. METHODS: To quantify interactions among cellular and skeletal muscle metabolic adaptations, and to predict metabolic responses to exercise after periods of altered loading states, we develop a computational model of skeletal muscle metabolism. The governing model equations - with parameters characterizing chronic loading/unloading states- were solved numerically to simulate metabolic responses to moderate intensity exercise (WR < or = 40% VO2 max). RESULTS: Model simulations showed that carbohydrate oxidation was 8.5% greater in chronically unloaded muscle compared with the loaded muscle (0.69 vs. 0.63 mmol/min), while fat oxidation was 7% higher in chronically loaded muscle (0.14 vs. 0.13 mmol/min), during exercise. Muscle oxygen uptake (VO2) and blood flow (Q) response times were 29% and 44% shorter in chronically loaded muscle (0.4 vs. 0.56 min for VO2 and 0.25 vs. 0.45 min for Q). CONCLUSION: The present model can be applied to test complex hypotheses during exercise involving the integration and control of metabolic processes at various organizational levels (cellular to tissue) in individuals who have undergone periods of chronic loading or unloading. [Abstract/Link to Full Text]

Ciaccio EJ, Hiatt M, Hegyi T, Drzewiecki GM
Measurement and monitoring of electrocardiogram belt tension in premature infants for assessment of respiratory function.
Biomed Eng Online. 2007;613.
BACKGROUND: Monitoring of the electrocardiogram (ECG) in premature infants with conventional adhesive-backed electrodes can harm their sensitive skin. Use of an electrode belt prevents skin irritation, but the effect of belt pressure on respiratory function is unknown. A strain gauge sensor is described which measures applied belt tension. METHOD: The device frame was comprised of an aluminum housing and slide to minimize the device weight. Velcro tabs connected housing and slide to opposite tabs located at the electrode belt ends. The slide was connected to a leaf spring, to which were bonded two piezoresistive transducers in a half-bridge circuit configuration. The device was tested for linearity and calibrated. The effect on infant respiratory function of constant belt tension in the normal range (30 g-90 g) was determined. RESULTS: The mechanical response to a step input was second order (fn = 401 Hz, zeta = 0.08). The relationship between applied tension and output voltage was linear in the range 25-225 gm of applied tension (r2 = 0.99). Measured device sensitivity was 2.18 mV/gm tension using a 5 V bridge excitation voltage. When belt tension was increased in the normal range from 30 gm to 90 gm, there was no significant change in heart rate and most respiratory functions during monitoring. At an intermediate level of tension of 50 gm, pulmonary resistance and work of breathing significantly decreased. CONCLUSION: The mechanical and electrical design of a device for monitoring electrocardiogram electrode belt tension is described. Within the typical range of application tension, cardiovascular and respiratory function are not substantially negatively affected by electrode belt force. [Abstract/Link to Full Text]

Teng ZZ, Ji GY, Chu HJ, Li ZY, Zou LJ, Xu ZY, Huang SD
Does PGA external stenting reduce compliance mismatch in venous grafts?
Biomed Eng Online. 2007;612.
BACKGROUND: Autogenous vein grafting is widely used in regular bypassing procedures. Due to its mismatch with the host artery in both mechanical property and geometry, the graft often over expands under high arterial blood pressure and forms a step-depth where eddy flow develops, thus causing restenosis, fibrous graft wall, etc. External stents, such as sheaths being used to cuff the graft, have been introduced to eliminate these mismatches and increase the patency. Although histological and immunochemical studies have shown some positive effects of the external stent, the mechanical mismatch under the protection of an external stent remains poorly analyzed. METHODS: In this study, the jugular veins taken from hypercholesterolemic rabbits were transplanted into the carotid arteries, and non-woven polyglycolic acid (PGA) fabric was used to fabricate the external stents to study the effect of the biodegradable external stent. Eight weeks after the operation, the grafts were harvested to perform mechanical tests and histological examinations. An arc tangent function was suggested to describe the relationship between pressure and cross-sectional area to analyse the compliance of the graft. RESULTS: The results from the mechanical tests indicated that grafts either with or without external stents displayed large compliance in the low-pressure range and were almost inextensible in the high-pressure range. This was very different from the behavior of the arteries or veins in vivo. The data from histological tests showed that, with external stents, collagen fibers were more compact, whilst those in the graft without protection were looser and thicker. No elastic fiber was found in either kind of grafts. Furthermore, grafts without protection were over-expanded which resulted in much bigger cross-sectional areas. CONCLUSION: The PGA external extent contributes little to the reduction of the mechanical mismatch between the graft and its host artery while remodeling develops. For the geometric mismatch, it reduces the cross-section area, therefore matching with the host artery much better. Although there are some positive effects, conclusively the PGA is not an ideal material for external stent. [Abstract/Link to Full Text]

Narkilahti S, Rajala K, Pihlajamäki H, Suuronen R, Hovatta O, Skottman H
Monitoring and analysis of dynamic growth of human embryonic stem cells: comparison of automated instrumentation and conventional culturing methods.
Biomed Eng Online. 2007;611.
BACKGROUND: Human embryonic stem cells (hESCs) are a potential source of cells for use in regenerative medicine. Automation of culturing, monitoring and analysis is crucial for fast and reliable optimization of hESC culturing methods. Continuous monitoring of living cell cultures can reveal more information and is faster than using laborious traditional methods such as microscopic evaluation, immunohistochemistry and flow cytometry. METHODS: We analyzed the growth dynamics of two hESC lines HS237 and HS293 in a conventional culture medium containing serum replacement and a xeno-free X-vivo 10 medium. We used a new automated culture platform utilizing machine vision technology, which enables automatic observation, recording and analysis of intact living cells. We validated the results using flow cytometry for cell counting and characterization. RESULTS: In our analyses, hESC colony growth could be continuously monitored and the proportion of undifferentiated cells automatically analyzed. No labeling was needed and we could, for the first time, perform detailed follow up of live, undisturbed cell colonies, and record all the events in the culture. The growth rate of the hESCs cultured in X-vivo 10 medium was significantly lower and a larger proportion of the cells were differentiated. CONCLUSION: The new automated system enables rapid and reliable analysis of undifferentiated growth dynamics of hESCs. We demonstrate the effectiveness of the system by comparing hESC growth in different culture conditions. [Abstract/Link to Full Text]

Mohamed SS, Salama MM
Spectral clustering for TRUS images.
Biomed Eng Online. 2007;610.
BACKGROUND: Identifying the location and the volume of the prostate is important for ultrasound-guided prostate brachytherapy. Prostate volume is also important for prostate cancer diagnosis. Manual outlining of the prostate border is able to determine the prostate volume accurately, however, it is time consuming and tedious. Therefore, a number of investigations have been devoted to designing algorithms that are suitable for segmenting the prostate boundary in ultrasound images. The most popular method is the deformable model (snakes), a method that involves designing an energy function and then optimizing this function. The snakes algorithm usually requires either an initial contour or some points on the prostate boundary to be estimated close enough to the original boundary which is considered a drawback to this powerful method. METHODS: The proposed spectral clustering segmentation algorithm is built on a totally different foundation that doesn't involve any function design or optimization. It also doesn't need any contour or any points on the boundary to be estimated. The proposed algorithm depends mainly on graph theory techniques. RESULTS: Spectral clustering is used in this paper for both prostate gland segmentation from the background and internal gland segmentation. The obtained segmented images were compared to the expert radiologist segmented images. The proposed algorithm obtained excellent gland segmentation results with 93% average overlap areas. It is also able to internally segment the gland where the segmentation showed consistency with the cancerous regions identified by the expert radiologist. CONCLUSION: The proposed spectral clustering segmentation algorithm obtained fast excellent estimates that can give rough prostate volume and location as well as internal gland segmentation without any user interaction. [Abstract/Link to Full Text]

Lian J, Clifford GD, Müssig D, Lang V
Open source model for generating RR intervals in atrial fibrillation and beyond.
Biomed Eng Online. 2007;69.
BACKGROUND: Realistic modeling of cardiac inter-beat (RR) intervals is highly desirable for basic research in cardiac electrophysiology, clinical management of heart diseases, and developing signal processing tools for ECG analysis. METHODS: We present an open source computer model that is capable to generate realistic time series of RR intervals in both physiologic and pathologic conditions. Detailed model structure and the software implementation are described. RESULTS: Examples are provided on how to use this model to generate RR intervals in atrial fibrillation with ventricular pacing, normal sinus rhythm with heart rate variability, and typical atrial flutter with atrioventricular block. The extensibility of the model is also discussed. CONCLUSION: The present computer model provides a unified platform wherein various types of ventricular rhythm can be simulated. The availability of this open source model promises to support and stimulate future studies. [Abstract/Link to Full Text]

Ley O, Kim T
Calculation of arterial wall temperature in atherosclerotic arteries: effect of pulsatile flow, arterial geometry, and plaque structure.
Biomed Eng Online. 2007;68.
BACKGROUND: This paper presents calculations of the temperature distribution in an atherosclerotic plaque experiencing an inflammatory process; it analyzes the presence of hot spots in the plaque region and their relationship to blood flow, arterial geometry, and inflammatory cell distribution. Determination of the plaque temperature has become an important topic because plaques showing a temperature inhomogeneity have a higher likelihood of rupture. As a result, monitoring plaque temperature and knowing the factors affecting it can help in the prevention of sudden rupture. METHODS: The transient temperature profile in inflamed atherosclerotic plaques is calculated by solving an energy equation and the Navier-Stokes equations in 2D idealized arterial models of a bending artery and an arterial bifurcation. For obtaining the numerical solution, the commercial package COMSOL 3.2 was used. The calculations correspond to a parametric study where arterial type and size, as well as plaque geometry and composition, are varied. These calculations are used to analyze the contribution of different factors affecting arterial wall temperature measurements. The main factors considered are the metabolic heat production of inflammatory cells, atherosclerotic plaque length lp, inflammatory cell layer length lmp, and inflammatory cell layer thickness dmp. RESULTS: The calculations indicate that the best location to perform the temperature measurement is at the back region of the plaque (0.5 < or = l/lp < or = 0.7). The location of the maximum temperature, or hot spot, at the plaque surface can move during the cardiac cycle depending on the arterial geometry and is a direct result of the blood flow pattern. For the bending artery, the hot spot moves 0.6 millimeters along the longitudinal direction; for the arterial bifurcation, the hot spot is concentrated at a single location due to the flow recirculation observed at both ends of the plaque. Focusing on the thermal history of different points selected at the plaque surface, it is seen that during the cardiac cycle the temperature at a point located at l/lp = 0.7 can change between 0.5 and 0.1 degrees Celsius for the bending artery, while no significant variation is observed in the arterial bifurcation. Calculations performed for different values of inflammatory cell layer thickness dmp indicate the same behavior reported experimentally; that corresponds to an increase in the maximum temperature observed, which for the bending artery ranges from 0.6 to 2.0 degrees Celsius, for dmp = 25 and 100 micrometers, respectively. CONCLUSION: The results indicate that direct temperature measurements should be taken (1) as close as possible to the plaque/lumen surface, as the calculations show a significant drop in temperature within 120 micrometers from the plaque surface; (2) in the presence of blood flow, temperature measurement should be performed in the downstream edge of the plaque, as it shows higher temperature independently of the arterial geometry; and (3) it is necessary to perform measurements at a sampling rate that is higher than the cardiac cycle; the measurement should be extended through several cardiac cycles, as variations of up to 0.7 degrees Celsius were observed at l/lp = 0.7 for the bending artery. [Abstract/Link to Full Text]

Albaiceta GM, Garcia E, Taboada F
Comparative study of four sigmoid models of pressure-volume curve in acute lung injury.
Biomed Eng Online. 2007;67.
BACKGROUND: The pressure-volume curve of the respiratory system is a tool to monitor and set mechanical ventilation in acute lung injury. Mathematical models of the static pressure-volume curve of the respiratory system have been proposed to overcome the inter- and intra-observer variability derived from eye-fitting. However, different models have not been compared. METHODS: The goodness-of-fit and the values of derived parameters (upper asymptote, maximum compliance and points of maximum curvature) in four sigmoid models were compared, using pressure-volume data from 30 mechanically ventilated patients during the early phase of acute lung injury. RESULTS: All models showed an excellent goodness-of-fit (R2 always above 0.92). There were significant differences between the models in the parameters derived from the inspiratory limb, but not in those derived from the expiratory limb of the curve. The within-case standard deviations of the pressures at the points of maximum curvature ranged from 2.33 to 6.08 cmH2O. CONCLUSION: There are substantial variabilities in relevant parameters obtained from the four different models of the static pressure-volume curve of the respiratory system. [Abstract/Link to Full Text]

Hopenfeld B
ST segment depression: the possible role of global repolarization dynamics.
Biomed Eng Online. 2007;66.
BACKGROUND: At least some clinical data suggests that, regardless of which major coronary artery is narrowed, the early ST segment body surface pattern is characterized by a minimum near precordial lead V5 and a broad area of left precordial negative potentials. Some clinical data also suggests that late ST segment potentials can localize an ischemic heart region. OBJECTIVE: A computer model of a heart/torso system was implemented to study the relationship between transmembrane potentials throughout the heart and clinically observed body surface potential patterns during the early and late ST segments in ischemic patients. METHODS: Transmembrane potentials were selected to produce body surface potentials that matched the clinical data. RESULTS: The early ST segment pattern was matched by assigning: (i) an epicardial transmembrane potential gradient that is consistent with the normal activation/repolarization sequence, according to which the left lateral epicardium activates relatively late; (ii) an endocardial transmembrane potential distribution with the lowest transmembrane potentials in the ischemic region; and (iii) overall lower transmembrane potentials to the endocardium compared to the epicardium. Late ST segment potentials, which localized the area of the ischemic region, were generated by reducing the epicardial transmembrane potential gradient and increasing the endocardial transmembrane potential gradient. CONCLUSION: The non-localizing nature of early ST segment depression could be due to global epicardial and endocardial transmembrane potential gradients related to the activation/repolarization sequence, whereas the possibly localizing nature of late ST segment depression could be due to the relative removal of the epicardial gradient, and an increase of the transmembrane potential gradient across the endocardium. [Abstract/Link to Full Text]

Stecker MM
Effect of neural connectivity on autocovariance and cross covariance estimates.
Biomed Eng Online. 2007;63.
BACKGROUND: Measurements of auto and cross covariance functions are frequently used to investigate neural systems. In interpreting this data, it is commonly assumed that the largest contribution to the recordings comes from sources near the electrode. However, the potential recorded at an electrode represents the superimposition of the potentials generated by large numbers of active neural structures. This creates situations under which the measured auto and cross covariance functions are dominated by the activity in structures far from the electrode and in which the distance dependence of the cross-covariance function differs significantly from that describing the activity in the actual neural structures. METHODS: Direct application of electrostatics to calculate the theoretical auto and cross covariance functions that would be recorded from electrodes immersed in a large volume filled with active neural structures with specific statistical properties. RESULTS: It is demonstrated that the potentials recorded from a monopolar electrode surrounded by dipole sources in a uniform medium are predominantly due to activity in neural structures far from the electrode when neuronal correlations drop more slowly than 1/r3 or when the size of the neural system is much smaller than a known correlation distance. Recordings from quadrupolar sources are strongly dependent on distant neurons when correlations drop more slowly than 1/r or the size of the system is much smaller than the correlation distance. Differences between bipolar and monopolar recordings are discussed. It is also demonstrated that the cross covariance of the recorded in two spatially separated electrodes declines as a power-law function of the distance between them even when the electrical activity from different neuronal structures is uncorrelated. CONCLUSION: When extracellular electrophysiologic recordings are made from systems containing large numbers of neural structures, it is important to interpret measured auto and cross covariance functions cautiously in light of the long range nature of the electric fields. Using recording electrodes that are bipolar or quadrupolar minimizes or eliminates these effects and hence these electrodes are preferred when electrical recordings are made for the purpose of auto and cross correlation analysis of local electrical activity. [Abstract/Link to Full Text]

Rossi L, Bianchi AM, Merzagora A, Gaggiani A, Cerutti S, Bracchi F
Single trial somatosensory evoked potential extraction with ARX filtering for a combined spinal cord intraoperative neuromonitoring technique.
Biomed Eng Online. 2007;62.
BACKGROUND: When spinal cord functional integrity is at risk during surgery, intraoperative neuromonitoring is recommended. Tibial Single Trial Somatosensory Evoked Potentials (SEPs) and H-reflex are here used in a combined neuromonitoring method: both signals monitor the spinal cord status, though involving different nervous pathways. However, SEPs express a trial-to-trial variability that is difficult to track because of the intrinsic low signal-to-noise ratio. For this reason single trial techniques are needed to extract SEPs from the background EEG. METHODS: The analysis is performed off line on data recorded in eight scoliosis surgery sessions during which the spinal cord was simultaneously monitored through classical SEPs and H-reflex responses elicited by the same tibial nerve electrical stimulation. The single trial extraction of SEPs from the background EEG is here performed through AutoRegressive filter with eXogenous input (ARX). The electroencephalographic recording can be modeled as the sum of the background EEG, which can be described as an autoregressive process not related to the stimulus, and the evoked potential (EP), which can be viewed as a filtered version of a reference signal related to the stimulus. The choice of the filter optimal orders is based on the Akaike Information Criterion (AIC). The reference signal used as exogenous input in the ARX model is a weighted average of the previous SEPs trials with exponential forgetting behavior. RESULTS: The moving average exponentially weighted, used as reference signal for the ARX model, shows a better sensibility than the standard moving average in tracking SEPs fast inter-trial changes. The ability to promptly detect changes allows highlighting relations between waveform changes and surgical maneuvers. It also allows a comparative study with H-reflex trends: in particular, the two signals show different fall and recovery dynamics following stressful conditions for the spinal cord. CONCLUSION: The ARX filter showed good performances in single trial SEP extraction, enhancing the available information concerning the current spinal cord status. Moreover, the comparison between SEPs and H-reflex showed that the two signals are affected by the same surgical maneuvers, even if they monitor the spinal cord through anatomically different pathways. [Abstract/Link to Full Text]

Rahe-Meyer N, Weilbach C, Karst M, Pawlak M, Ahmed A, Piepenbrock S, Winterhalter M
In vivo myograph measurement of muscle contraction at optimal length.
Biomed Eng Online. 2007;61.
BACKGROUND: Current devices for measuring muscle contraction in vivo have limited accuracy in establishing and re-establishing the optimum muscle length. They are variable in the reproducibility to determine the muscle contraction at this length, and often do not maintain precise conditions during the examination. Consequently, for clinical testing only semi-quantitative methods have been used. METHODS: We present a newly developed myograph, an accurate measuring device for muscle contraction, consisting of three elements. Firstly, an element for adjusting the axle of the device and the physiological axis of muscle contraction; secondly, an element to accurately position and reposition the extremity of the muscle; and thirdly, an element for the progressive pre-stretching and isometric locking of the target muscle.Thus it is possible to examine individual in vivo muscles in every pre-stretched, specified position, to maintain constant muscle-length conditions, and to accurately re-establish the conditions of the measurement process at later sessions. RESULTS: In a sequence of experiments the force of contraction of the muscle at differing stretching lengths were recorded and the forces determined. The optimum muscle length for maximal force of contraction was established. In a following sequence of experiments with smaller graduations around this optimal stretching length an increasingly accurate optimum muscle length for maximal force of contraction was determined. This optimum length was also accurately re-established at later sessions. CONCLUSION: We have introduced a new technical solution for valid, reproducible in vivo force measurements on every possible point of the stretching curve. Thus it should be possible to study the muscle contraction in vivo to the same level of accuracy as is achieved in tests with in vitro organ preparations. [Abstract/Link to Full Text]

Dutta R, Dutta R
Intelligent Bayes Classifier (IBC) for ENT infection classification in hospital environment.
Biomed Eng Online. 2006;565.
Electronic Nose based ENT bacteria identification in hospital environment is a classical and challenging problem of classification. In this paper an electronic nose (e-nose), comprising a hybrid array of 12 tin oxide sensors (SnO2) and 6 conducting polymer sensors has been used to identify three species of bacteria, Escherichia coli (E. coli), Staphylococcus aureus (S. aureus), and Pseudomonas aeruginosa (P. aeruginosa) responsible for ear nose and throat (ENT) infections when collected as swab sample from infected patients and kept in ISO agar solution in the hospital environment. In the next stage a sub-classification technique has been developed for the classification of two different species of S. aureus, namely Methicillin-Resistant S. aureus (MRSA) and Methicillin Susceptible S. aureus (MSSA). An innovative Intelligent Bayes Classifier (IBC) based on "Baye's theorem" and "maximum probability rule" was developed and investigated for these three main groups of ENT bacteria. Along with the IBC three other supervised classifiers (namely, Multilayer Perceptron (MLP), Probabilistic neural network (PNN), and Radial Basis Function Network (RBFN)) were used to classify the three main bacteria classes. A comparative evaluation of the classifiers was conducted for this application. IBC outperformed MLP, PNN and RBFN. The best results suggest that we are able to identify and classify three bacteria main classes with up to 100% accuracy rate using IBC. We have also achieved 100% classification accuracy for the classification of MRSA and MSSA samples with IBC. We can conclude that this study proves that IBC based e-nose can provide very strong and rapid solution for the identification of ENT infections in hospital environment. [Abstract/Link to Full Text]

Indebetouw G, Tada Y, Leacock J
Quantitative phase imaging with scanning holographic microscopy: an experimental assessment.
Biomed Eng Online. 2006;563.
This paper demonstrates experimentally how quantitative phase information can be obtained in scanning holographic microscopy. Scanning holography can operate in both coherent and incoherent modes, simultaneously if desired, with different detector geometries. A spatially integrating detector provides an incoherent hologram of the object's intensity distribution (absorption and/or fluorescence, for example), while a point detector in a conjugate plane of the pupil provides a coherent hologram of the object's complex amplitude, from which a quantitative measure of its phase distribution can be extracted. The possibility of capturing simultaneously holograms of three-dimensional specimens, leading to three-dimensional reconstructions with absorption contrast, reflectance contrast, fluorescence contrast, as was previously demonstrated, and quantitative phase contrast, as shown here for the first time, opens up new avenues for multimodal imaging in biological studies. [Abstract/Link to Full Text]

Gandhi SV, Walker DC, Brown BH, Anumba DO
Comparison of human uterine cervical electrical impedance measurements derived using two tetrapolar probes of different sizes.
Biomed Eng Online. 2006;562.
BACKGROUND: We sought to compare uterine cervical electrical impedance spectroscopy measurements employing two probes of different sizes, and to employ a finite element model to predict and compare the fraction of electrical current derived from subepithelial stromal tissue. METHODS: Cervical impedance was measured in 12 subjects during early pregnancy using 2 different sizes of the probes on each subject. RESULTS: Mean cervical resistivity was significantly higher (5.4 vs. 2.8 Omegam; p < 0.001) with the smaller probe in the frequency rage of 4-819 kHz. There was no difference in the short-term intra-observer variability between the two probes. The cervical impedance measurements derived in vivo followed the pattern predicted by the finite element model. CONCLUSION: Inter-electrode distance on the probes for measuring cervical impedance influences the tissue resistivity values obtained. Determining the appropriate probe size is necessary when conducting clinical studies of resistivity of the cervix and other human tissues. [Abstract/Link to Full Text]

Hopenfeld B
A convenient scheme for coupling a finite element curvilinear mesh to a finite element voxel mesh: application to the heart.
Biomed Eng Online. 2006;560.
BACKGROUND: In some cases, it may be necessary to combine distinct finite element meshes into a single system. The present work describes a scheme for coupling a finite element mesh, which may have curvilinear elements, to a voxel based finite element mesh. METHODS: The method is described with reference to a sample problem that involves combining a heart, which is defined by a curvilinear mesh, with a voxel based torso mesh. The method involves the creation of a temporary (scaffolding) mesh that couples the outer surface of the heart mesh to a voxel based torso mesh. The inner surface of the scaffolding mesh is the outer heart surface, and the outer surface of the scaffolding mesh is defined by the nodes in the torso mesh that are nearest (but outside of) the heart. The finite element stiffness matrix for the scaffolding mesh is then computed. This stiffness matrix includes extraneous nodes that are then removed, leaving a coupling matrix that couples the original outer heart surface nodes to adjacent nodes in the torso voxel mesh. Finally, a complete system matrix is assembled from the pre-existing heart stiffness matrix, the heart/torso coupling matrix, and the torso stiffness matrix. RESULTS: Realistic body surface electrocardiograms were generated. In a test involving a dipole embedded in a spherical shell, relative error of the scheme rapidly converged to slightly over 4%, although convergence thereafter was relatively slow. CONCLUSION: The described method produces reasonably accurate results and may be best suited for problems where computational speed and convenience have a higher priority than very high levels of accuracy. [Abstract/Link to Full Text]

Borghi A, Wood NB, Mohiaddin RH, Xu XY
3D geometric reconstruction of thoracic aortic aneurysms.
Biomed Eng Online. 2006;559.
BACKGROUND: The thoracic aortic aneurysm (TAA) is a pathology that involves an expansion of the aortic diameter in the thoracic aorta, leading to risk of rupture. Recent studies have suggested that internal wall stress, which is affected by TAA geometry and the presence or absence of thrombus, is a more reliable predictor of rupture than the maximum diameter, the current clinical criterion. Accurate reconstruction of TAA geometry is a crucial step in patient-specific stress calculations. METHODS: In this work, a novel methodology was developed, which combines data from several sets of magnetic resonance (MR) images with different levels of detail and different resolutions. Two sets of images were employed to create the final model, which has the highest level of detail for each component of the aneurysm (lumen, thrombus, and wall). A reference model was built by using a single set of images for comparison. This approach was applied to two patient-specific TAAs in the descending thoracic aorta. RESULTS: The results of finite element simulations showed differences in stress pattern between the coarse and fine models: higher stress values were found with the coarse model and the differences in predicted maximum wall stress were 30% for patient A and 11% for patient B. CONCLUSION: This paper presents a new approach to the reconstruction of an aneurysm model based on the use of several sets of MR images. This enables more accurate representation of not only the lumen but also the wall surface of a TAA taking account of intraluminal thrombus. [Abstract/Link to Full Text]

Verhey JF, Nathan NS
Utilizing FEM-Software to quantify pre- and post-interventional cardiac reconstruction data based on modelling data sets from surgical ventricular repair therapy (SVRT) and cardiac resynchronisation therapy (CRT).
Biomed Eng Online. 2006;558.
BACKGROUND: Left ventricle (LV) 3D structural data can be easily obtained using standard transesophageal echocardiography (TEE) devices but quantitative pre- and intraoperative volumetry and geometry analysis of the LV is presently not feasible in the cardiac operation room (OR). Finite element method (FEM) modelling is necessary to carry out precise and individual volume analysis and in the future will form the basis for simulation of cardiac interventions. METHOD: A Philips/HP Sonos 5500 ultrasound device stores volume data as time-resolved 4D volume data sets. In this prospective study TomTec LV Analysis TEE Software was used for semi-automatic endocardial border detection, reconstruction, and volume-rendering of the clinical 3D echocardiographic data. With the software FemCoGen a quantification of partial volumes and surface directions of the LV was carried out for two patients data sets. One patient underwent surgical ventricular repair therapy (SVR) and the other a cardiac resynchronisation therapy (CRT). RESULTS: For both patients a detailed volume and surface direction analysis is provided. Partial volumes as well as normal directions to the LV surface are pre- and post-interventionally compared. CONCLUSION: The operation results for both patients are quantified. The quantification shows treatment details for both interventions (e.g. the elimination of the discontinuities for CRT intervention and the segments treated for SVR intervention). The LV quantification is feasible in the cardiac OR and it gives a detailed and immediate quantitative feedback of the quality of the intervention to the medical. [Abstract/Link to Full Text]

Tangwongsan C, Chachati L, Webster JG, Farrell PV
In vitro calibration of a system for measurement of in vivo convective heat transfer coefficient in animals.
Biomed Eng Online. 2006;557.
BACKGROUND: We need a sensor to measure the convective heat transfer coefficient during ablation of the heart or liver. METHODS: We built a minimally invasive instrument to measure the in vivo convective heat transfer coefficient, h in animals, using a Wheatstone-bridge circuit, similar to a hot-wire anemometer circuit. One arm is connected to a steerable catheter sensor whose tip is a 1.9 mm x 3.2 mm thin film resistive temperature detector (RTD) sensor. We used a circulation system to simulate different flow rates at 39 degrees C for in vitro experiments using distilled water, tap water and saline. We heated the sensor approximately 5 degrees C above the fluid temperature. We measured the power consumed by the sensor and the resistance of the sensor during the experiments and analyzed these data to determine the value of the convective heat transfer coefficient at various flow rates. RESULTS: From 0 to 5 L/min, experimental values of h in W/(m2.K) were for distilled water 5100 to 13000, for tap water 5500 to 12300, and for saline 5400 to 13600. Theoretical values were 1900 to 10700. CONCLUSION: We believe this system is the smallest, most accurate method of minimally invasive measurement of in vivo h in animals and provides the least disturbance of flow. [Abstract/Link to Full Text]

Al-Bataineh OM, Collins CM, Park EJ, Lee H, Smith NB
MR thermometry characterization of a hyperthermia ultrasound array designed using the k-space computational method.
Biomed Eng Online. 2006;556.
BACKGROUND: Ultrasound induced hyperthermia is a useful adjuvant to radiation therapy in the treatment of prostate cancer. A uniform thermal dose (43 degrees C for 30 minutes) is required within the targeted cancerous volume for effective therapy. This requires specific ultrasound phased array design and appropriate thermometry method. Inhomogeneous, acoustical, three-dimensional (3D) prostate models and economical computational methods provide necessary tools to predict the appropriate shape of hyperthermia phased arrays for better focusing. This research utilizes the k-space computational method and a 3D human prostate model to design an intracavitary ultrasound probe for hyperthermia treatment of prostate cancer. Evaluation of the probe includes ex vivo and in vivo controlled hyperthermia experiments using the noninvasive magnetic resonance imaging (MRI) thermometry. METHODS: A 3D acoustical prostate model was created using photographic data from the Visible Human Project. The k-space computational method was used on this coarse grid and inhomogeneous tissue model to simulate the steady state pressure wavefield of the designed phased array using the linear acoustic wave equation. To ensure the uniformity and spread of the pressure in the length of the array, and the focusing capability in the width of the array, the equally-sized elements of the 4 x 20 elements phased array were 1 x 14 mm. A probe was constructed according to the design in simulation using lead zerconate titanate (PZT-8) ceramic and a Delrin plastic housing. Noninvasive MRI thermometry and a switching feedback controller were used to accomplish ex vivo and in vivo hyperthermia evaluations of the probe. RESULTS: Both exposimetry and k-space simulation results demonstrated acceptable agreement within 9%. With a desired temperature plateau of 43.0 degrees C, ex vivo and in vivo controlled hyperthermia experiments showed that the MRI temperature at the steady state was 42.9 +/- 0.38 degrees C and 43.1 +/- 0.80 degrees C, respectively, for 20 minutes of heating. CONCLUSION: Unlike conventional computational methods, the k-space method provides a powerful tool to predict pressure wavefield in large scale, 3D, inhomogeneous and coarse grid tissue models. Noninvasive MRI thermometry supports the efficacy of this probe and the feedback controller in an in vivo hyperthermia treatment of canine prostate. [Abstract/Link to Full Text]

Ramon C, Haueisen J, Schimpf PH
Influence of head models on neuromagnetic fields and inverse source localizations.
Biomed Eng Online. 2006;555.
BACKGROUND: The magnetoencephalograms (MEGs) are mainly due to the source currents. However, there is a significant contribution to MEGs from the volume currents. The structure of the anatomical surfaces, e.g., gray and white matter, could severely influence the flow of volume currents in a head model. This, in turn, will also influence the MEGs and the inverse source localizations. This was examined in detail with three different human head models. METHODS: Three finite element head models constructed from segmented MR images of an adult male subject were used for this study. These models were: (1) Model 1: full model with eleven tissues that included detailed structure of the scalp, hard and soft skull bone, CSF, gray and white matter and other prominent tissues, (2) the Model 2 was derived from the Model 1 in which the conductivity of gray matter was set equal to the white matter, i.e., a ten tissuetype model, (3) the Model 3 consisted of scalp, hard skull bone, CSF, gray and white matter, i.e., a five tissue-type model. The lead fields and MEGs due to dipolar sources in the motor cortex were computed for all three models. The dipolar sources were oriented normal to the cortical surface and had a dipole moment of 100 microA meter. The inverse source localizations were performed with an exhaustive search pattern in the motor cortex area. A set of 100 trial inverse runs was made covering the 3 cm cube motor cortex area in a random fashion. The Model 1 was used as a reference model. RESULTS: The reference model (Model 1), as expected, performed best in localizing the sources in the motor cortex area. The Model 3 performed the worst. The mean source localization errors (MLEs) of the Model 3 were larger than the Model 1 or 2. The contour plots of the magnetic fields on top of the head were also different for all three models. The magnetic fields due to source currents were larger in magnitude as compared to the magnetic fields of volume currents. DISCUSSION: These results indicate that the complexity of head models strongly influences the MEGs and the inverse source localizations. A more complex head model performs better in inverse source localizations as compared to a model with lesser tissue surfaces. [Abstract/Link to Full Text]

Lukic KZ, Urch B, Fila M, Faughnan ME, Silverman F
A novel application of capnography during controlled human exposure to air pollution.
Biomed Eng Online. 2006;554.
BACKGROUND: The objective was to determine the repeatability and stability of capnography interfaced with human exposure facility. METHODS: Capnographic wave signals were obtained from five healthy volunteers exposed to particle-free, filtered air during two consecutive 5 min intervals, 10 min apart, within the open and then the sealed and operational human exposure facility (HEF). Using a customized setup comprised of the Oridion Microcap portable capnograph, DA converter and AD card, the signal was acquired and saved as an ASCII file for subsequent processing. The minute ventilation (VE), respiratory rate (RR) and expiratory tidal volume (VTE) were recorded before and after capnographic recording and then averaged. Each capnographic tracing was analyzed for acceptable waves. From each recorded interval, 8 to 19 acceptable waves were selected and measured. The following wave parameters were obtained: total length and length of phase II and III, slope of phase II and III, area under the curve and area under phase III. In addition, we recorded signal measures including the mean, standard deviation, mode, minimum, maximum--which equals end-tidal CO2 (EtCO2), zero-corrected maximum and true RMS. RESULTS: Statistical analysis using a paired t-test for means showed no statistically significant changes of any wave parameters and wave signal measures, corrected for RR and VTE, comparing the measures when the HEF was open vs. sealed and operational. The coefficients of variation of the zero-corrected and uncorrected EtCO2, phase II absolute difference, signal mean, standard deviation and RMS were less than 10% despite a sub-atmospheric barometric pressure, and slightly higher temperature and relative humidity within the HEF when operational. CONCLUSION: We showed that a customized setup for the acquisition and processing of the capnographic wave signal, interfaced with HEF was stable and repeatable. Thus, we expect that analysis of capnographic waves in controlled human air pollution exposure studies is a feasible tool for characterization of cardio-pulmonary effects of such exposures. [Abstract/Link to Full Text]

Cai Z, Stolpen A, Sharafuddin MJ, McCabe R, Bai H, Potts T, Vannier M, Li D, Bi X, Bennett J, Golzarian J, Sun S, Wang G, Bai EW
Bolus characteristics based on Magnetic Resonance Angiography.
Biomed Eng Online. 2006;553.
BACKGROUND: A detailed contrast bolus propagation model is essential for optimizing bolus-chasing Computed Tomography Angiography (CTA). Bolus characteristics were studied using bolus-timing datasets from Magnetic Resonance Angiography (MRA) for adaptive controller design and validation. METHODS: MRA bolus-timing datasets of the aorta in thirty patients were analyzed by a program developed with MATLAB. Bolus characteristics, such as peak position, dispersion and bolus velocity, were studied. The bolus profile was fit to a convolution function, which would serve as a mathematical model of bolus propagation in future controller design. RESULTS: The maximum speed of the bolus in the aorta ranged from 5-13 cm/s and the dwell time ranged from 7-13 seconds. Bolus characteristics were well described by the proposed propagation model, which included the exact functional relationships between the parameters and aortic location. CONCLUSION: The convolution function describes bolus dynamics reasonably well and could be used to implement the adaptive controller design. [Abstract/Link to Full Text]

Sharma D, Agrawal A, Matchette LS, Pfefer TJ
Evaluation of a fiberoptic-based system for measurement of optical properties in highly attenuating turbid media.
Biomed Eng Online. 2006;549.
BACKGROUND: Accurate measurements of the optical properties of biological tissue in the ultraviolet A and short visible wavelengths are needed to achieve a quantitative understanding of novel optical diagnostic devices. Currently, there is minimal information on optical property measurement approaches that are appropriate for in vivo measurements in highly absorbing and scattering tissues. We describe a novel fiberoptic-based reflectance system for measurement of optical properties in highly attenuating turbid media and provide an extensive in vitro evaluation of its accuracy. The influence of collecting reflectance at the illumination fiber on estimation accuracy is also investigated. METHODS: A neural network algorithm and reflectance distributions from Monte Carlo simulations were used to generate predictive models based on the two geometries. Absolute measurements of diffuse reflectance were enabled through calibration of the reflectance system. Spatially-resolved reflectance distributions were measured in tissue phantoms at 405 nm for absorption coefficients (mu(a)) from 1 to 25 cm-1 and reduced scattering coefficients (mu'(s)) from 5 to 25 cm-1. These data and predictive models were used to estimate the optical properties of tissue-simulating phantoms. RESULTS: By comparing predicted and known optical properties, the average errors for mu(a) and mu'(s) were found to be 3.0% and 4.6%, respectively, for a linear probe approach. When bifurcated probe data was included and samples with mu(a) values less than 5 cm-1 were excluded, predictive errors for mu(a) and mu'(s) were further reduced to 1.8% and 3.5%. CONCLUSION: Improvements in system design have led to significant reductions in optical property estimation error. While the incorporation of a bifurcated illumination fiber shows promise for improving the accuracy of mu's estimates, further study of this approach is needed to elucidate the source of discrepancies between measurements and simulation results at low mu(a) values. [Abstract/Link to Full Text]

Ramasamy L, Sperelakis N
Transverse propagation in an expanded PSpice model for cardiac muscle with gap-junction ion channels.
Biomed Eng Online. 2006;546.
Transverse propagation was previously found to occur in a two-dimensional model of cardiac muscle using the PSpice software program for electronic circuit design and analysis. Longitudinal propagation within each chain, and transverse propagation between parallel chains, occurred even when there were no gap-junction (g-j) channels inserted between the simulated myocardial cells either longitudinally or transversely. In those studies, there were pronounced edge (boundary) effects and end-effects even within single chains. Transverse velocity increased with increase in model size. The present study was performed to examine boundary effects on transverse propagation velocity when the length of the chains was held constant at 10 cells and the number of parallel chains was varied from 3 to 5, to 7, to 10, and to 20. The number of g-j channels was either zero, both longitudinally and transversely (0/0), or 100/100. Some experiments were also made at 100/0, 1/1, and 10/10. Transverse velocity and overall velocity (both longitudinal and transverse components) was calculated from the measured total propagation time (TPT), i.e., the elapsed time between when the first action potential (AP) and the last AP crossed the zero potential level. The transverse g-j channels were placed only at the ends of each chain, such that propagation would occur in a zigzag pattern. Electrical stimulation was applied intracellularly between cells A1 and A2. It was found that, with no g-j channels (0/0), overall velocity increased almost linearly when more and more chains were placed in parallel. In contrast, with many g-j channels (100/100), there was a much flatter relationship between overall velocity and number of parallel chains. The difference in velocities with 0/0 channels and 100/100 channels was reduced as the number of chains was increased. In conclusion, edges have important effects on propagation velocity (overall and transverse) in cardiac muscle simulations. [Abstract/Link to Full Text]

Reich T, Gefen A
Effect of trabecular bone loss on cortical strain rate during impact in an in vitro model of avian femur.
Biomed Eng Online. 2006;545.
BACKGROUND: Osteoporotic hip fractures occur due to loss of cortical and trabecular bone mass and consequent degradation in whole bone strength. The direct cause of most fractures is a fall, and hence, characterizing the mechanical behavior of a whole osteopenic bone under impact is important. However, very little is known about the mechanical interactions between cortical and trabecular bone during impact, and it is specifically unclear to what extent epiphyseal trabecular bone contributes to impact resistance of whole bones. We hypothesized that trabecular bone serves as a structural support to the cortex during impact, and hence, loss of a critical mass of trabecular bone reduces internal constraining of the cortex, and, thereby, decreases the impact tolerance of the whole bone. METHODS: To test this hypothesis, we conducted cortical strain rate measurements in adult chicken's proximal femora subjected to a Charpy impact test, after removing different trabecular bone core masses to simulate different osteopenic severities. RESULTS: We found that removal of core trabecular bone decreased by ~10-fold the cortical strain rate at the side opposite to impact (p < 0.01), i.e. from 359,815 +/- 1799 microm/m per second (mean +/- standard error) for an intact (control) specimen down to 35,997 +/- 180 microm/m per second where 67% of the total trabecular bone mass (approximately 0.7 grams in adult chicken) were removed. After normalizing the strain rate by the initial weight of bone specimens, a sigmoid relation emerged between normalized strain rate and removed mass of trabecular bone, showing very little effect on the cortex strain rate if below 10% of the trabecular mass is removed, but most of the effect was already apparent for less than 30% trabecular bone loss. An analytical model of the experiments supported this behavior. CONCLUSION: We conclude that in our in vitro avian model, loss of over 10% of core trabecular bone substantially altered the deformation response of whole bone to impact, which supports the above hypothesis and indicates that integrity of trabecular bone is critical for resisting impact loads. [Abstract/Link to Full Text]

Nittala A, Ghosh S, Stefanovski D, Bergman R, Wang X
Dimensional analysis of MINMOD leads to definition of the disposition index of glucose regulation and improved simulation algorithm.
Biomed Eng Online. 2006;544.
BACKGROUND: Frequently Sampled Intravenous Glucose Tolerance Test (FSIVGTT) together with its mathematical model, the minimal model (MINMOD), have become important clinical tools to evaluate the metabolic control of glucose in humans. Dimensional analysis of the model is up to now not available. METHODS: A formal dimensional analysis of MINMOD was carried out and the degree of freedom of MINMOD was examined. Through re-expressing all state variable and parameters in terms of their reference scales, MINMOD was transformed into a dimensionless format. Previously defined physiological indices including insulin sensitivity, glucose effectiveness, and first and second phase insulin responses were re-examined in this new formulation. Further, the parameter estimation from FSIVGTT was implemented using both the dimensional and the dimensionless formulations of MINMOD, and the performances were compared utilizing Monte Carlo simulation as well as real human FSIVGTT data. RESULTS: The degree of freedom (DOF) of MINMOD was found to be 7. The model was maximally simplified in the dimensionless formulation that normalizes the variation in glucose and insulin during FSIVGTT. In the new formulation, the disposition index (Dl), a composite parameter known to be important in diabetes pathology, was naturally defined as one of the dimensionless parameters in the system. The numerical simulation using the dimensionless formulation led to a 1.5-5 fold gain in speed, and significantly improved accuracy and robustness in parameter estimation compared to the dimensional implementation. CONCLUSION: Dimensional analysis of MINMOD led to simplification of the model, direct identification of the important composite factors in the dynamics of glucose metabolic control, and better simulations algorithms. [Abstract/Link to Full Text]

Boutayeb A, Chetouani A
A critical review of mathematical models and data used in diabetology.
Biomed Eng Online. 2006;543.
The literature dealing with mathematical modelling for diabetes is abundant. During the last decades, a variety of models have been devoted to different aspects of diabetes, including glucose and insulin dynamics, management and complications prevention, cost and cost-effectiveness of strategies and epidemiology of diabetes in general. Several reviews are published regularly on mathematical models used for specific aspects of diabetes. In the present paper we propose a global overview of mathematical models dealing with many aspects of diabetes and using various tools. The review includes, side by side, models which are simple and/or comprehensive; deterministic and/or stochastic; continuous and/or discrete; using ordinary differential equations, partial differential equations, optimal control theory, integral equations, matrix analysis and computer algorithms. [Abstract/Link to Full Text]

Bernhard S, Möhlenkamp S, Tilgner A
Transient integral boundary layer method to calculate the translesional pressure drop and the fractional flow reserve in myocardial bridges.
Biomed Eng Online. 2006;542.
BACKGROUND: The pressure drop-flow relations in myocardial bridges and the assessment of vascular heart disease via fractional flow reserve (FFR) have motivated many researchers the last decades. The aim of this study is to simulate several clinical conditions present in myocardial bridges to determine the flow reserve and consequently the clinical relevance of the disease. From a fluid mechanical point of view the pathophysiological situation in myocardial bridges involves fluid flow in a time dependent flow geometry, caused by contracting cardiac muscles overlying an intramural segment of the coronary artery. These flows mostly involve flow separation and secondary motions, which are difficult to calculate and analyse. METHODS: Because a three dimensional simulation of the haemodynamic conditions in myocardial bridges in a network of coronary arteries is time-consuming, we present a boundary layer model for the calculation of the pressure drop and flow separation. The approach is based on the assumption that the flow can be sufficiently well described by the interaction of an inviscid core and a viscous boundary layer. Under the assumption that the idealised flow through a constriction is given by near-equilibrium velocity profiles of the Falkner-Skan-Cooke (FSC) family, the evolution of the boundary layer is obtained by the simultaneous solution of the Falkner-Skan equation and the transient von-Kármán integral momentum equation. RESULTS: The model was used to investigate the relative importance of several physical parameters present in myocardial bridges. Results have been obtained for steady and unsteady flow through vessels with 0 - 85% diameter stenosis. We compare two clinical relevant cases of a myocardial bridge in the middle segment of the left anterior descending coronary artery (LAD). The pressure derived FFR of fixed and dynamic lesions has shown that the flow is less affected in the dynamic case, because the distal pressure partially recovers during re-opening of the vessel in diastole. We have further calculated the wall shear stress (WSS) distributions in addition to the location and length of the flow reversal zones in dependence on the severity of the disease. CONCLUSION: The described boundary layer method can be used to simulate frictional forces and wall shear stresses in the entrance region of vessels. Earlier models are supplemented by the viscous effects in a quasi three-dimensional vessel geometry with a prescribed wall motion. The results indicate that the translesional pressure drop and the mean FFR compares favourably to clinical findings in the literature. We have further shown that the mean FFR under the assumption of Hagen-Poiseuille flow is overestimated in developing flow conditions. [Abstract/Link to Full Text]

LaDisa JF, Olson LE, Douglas HA, Warltier DC, Kersten JR, Pagel PS
Alterations in regional vascular geometry produced by theoretical stent implantation influence distributions of wall shear stress: analysis of a curved coronary artery using 3D computational fluid dynamics modeling.
Biomed Eng Online. 2006;540.
BACKGROUND: The success of stent implantation in the restoration of blood flow through areas of vascular narrowing is limited by restenosis. Several recent studies have suggested that the local geometric environment created by a deployed stent may influence regional blood flow characteristics and alter distributions of wall shear stress (WSS) after implantation, thereby rendering specific areas of the vessel wall more susceptible to neointimal hyperplasia and restenosis. Stents are most frequently implanted in curved vessels such as the coronary arteries, but most computational studies examining blood flow patterns through stented vessels conducted to date use linear, cylindrical geometric models. It appears highly probable that restenosis occurring after stent implantation in curved arteries also occurs as a consequence of changes in fluid dynamics that are established immediately after stent implantation. METHODS: In the current investigation, we tested the hypothesis that acute changes in stent-induced regional geometry influence distributions of WSS using 3D coronary artery CFD models implanted with stents that either conformed to or caused straightening of the primary curvature of the left anterior descending coronary artery. WSS obtained at several intervals during the cardiac cycle, time averaged WSS, and WSS gradients were calculated using conventional techniques. RESULTS: Implantation of a stent that causes straightening, rather than conforms to the natural curvature of the artery causes a reduction in the radius of curvature and subsequent increase in the Dean number within the stented region. This straightening leads to modest skewing of the velocity profile at the inlet and outlet of the stented region where alterations in indices of WSS are most pronounced. For example, time-averaged WSS in the proximal portion of the stent ranged from 8.91 to 11.7 dynes/cm2 along the pericardial luminal surface and 4.26 to 4.88 dynes/cm2 along the myocardial luminal surface of curved coronary arteries as compared to 8.31 dynes/cm2 observed throughout the stented region of a straight vessel implanted with an equivalent stent. CONCLUSION: The current results predicting large spatial and temporal variations in WSS at specific locations in curved arterial 3D CFD simulations are consistent with clinically observed sites of restenosis. If the findings of this idealized study translate to the clinical situation, the regional geometry established immediately after stent implantation may predispose portions of the stented vessel to a higher risk of neointimal hyperplasia and subsequent restenosis. [Abstract/Link to Full Text]

---

Recent Articles in Journal of Biomedicine & Biotechnology

---

Venturini L, Eder M, Scherr M
RNA-Mediated Gene Silencing in Hematopoietic Cells.
J Biomed Biotechnol. 2006;2006(4):87340.
In the past few years, the discovery of RNA-mediated gene silencing mechanisms, like RNA interference (RNAi), has revolutionized our understanding of eukaryotic gene expression. These mechanisms are activated by double-stranded RNA (dsRNA) and mediate gene silencing either by inducing the sequence-specific degradation of complementary mRNA or by inhibiting mRNA translation. RNAi now provides a powerful experimental tool to elucidate gene function in vitro and in vivo, thereby opening new exciting perspectives in the fields of molecular analysis and eventually therapy of several diseases such as infections and cancer. In hematology, numerous studies have described the successful application of RNAi to better define the role of oncogenic fusion proteins in leukemogenesis and to explore therapeutic approaches in hematological malignancies. In this review, we highlight recent advances and caveats relating to the application of this powerful new methodology to hematopoiesis. [Abstract/Link to Full Text]

Kurreck J
siRNA Efficiency: Structure or Sequence-That Is the Question.
J Biomed Biotechnol. 2006;2006(4):83757.
The triumphant success of RNA interference (RNAi) in life sciences is based on its high potency to silence genes in a sequence-specific manner. Nevertheless, the first task for successful RNAi approaches is the identification of highly active small interfering RNAs (siRNAs). Early on, it has been found that the potency of siRNAs can vary drastically. Great progress was made when thermodynamic properties that influence siRNA activity were discovered. Design algorithms based on these parameters enhance the chance to generate potent siRNAs. Still, many siRNAs designed accordingly fail to silence their targeted gene, whereas others are highly efficient despite the fact that they do not fulfil the recommended criteria. Therefore, the accessibility of the siRNA-binding site on the target RNA has been investigated as an additional parameter which is important for RNAi-mediated silencing. These and other factors which are crucial for successful RNAi approaches will be discussed in the present review. [Abstract/Link to Full Text]

Cerchia L, De Franciscis V
Noncoding RNAs in Cancer Medicine.
J Biomed Biotechnol. 2006;2006(4):73104.
Several signalling proteins involved in cell growth and differentiation represent attractive candidate targets for cancer diagnosis and/or therapy since they can act as oncogenes. Because of their high specificity and low immunogeneicity, using artificial small noncoding RNA (ncRNAs) as therapeutics has recently become a highly promising and rapidly expanding field of interest. Indeed, ncRNAs may either interfere with RNA transcription, stability, translation or directly hamper the function of the targets by binding to their surface. The recent finding that the expression of several genes is under the control of small single-stranded regulatory RNAs, including miRNAs, makes these genes as appropriate targets for ncRNA gene silencing. Furthermore, another class of small ncRNA, aptamers, act as high-affinity ligands and potential antagonists of disease-associated proteins. We will review here the recent and innovative methods that have been developed and the possible applications of ncRNAs as inhibitors or tracers in cancer medicine. [Abstract/Link to Full Text]

Aigner A
Delivery Systems for the Direct Application of siRNAs to Induce RNA Interference (RNAi) In Vivo.
J Biomed Biotechnol. 2006;2006(4):71659.
RNA interference (RNAi) is a powerful method for specific gene silencing which may also lead to promising novel therapeutic strategies. It is mediated through small interfering RNAs (siRNAs) which sequence-specifically trigger the cleavage and subsequent degradation of their target mRNA. One critical factor is the ability to deliver intact siRNAs into target cells/organs in vivo. This review highlights the mechanism of RNAi and the guidelines for the design of optimal siRNAs. It gives an overview of studies based on the systemic or local application of naked siRNAs or the use of various nonviral siRNA delivery systems. One promising avenue is the the complexation of siRNAs with the polyethylenimine (PEI), which efficiently stabilizes siRNAs and, upon systemic administration, leads to the delivery of the intact siRNAs into different organs. The antitumorigenic effects of PEI/siRNA-mediated in vivo gene-targeting of tumor-relevant proteins like in mouse tumor xenograft models are described. [Abstract/Link to Full Text]

Ouellet DL, Perron MP, Gobeil LA, Plante P, Provost P
MicroRNAs in Gene Regulation: When the Smallest Governs It All.
J Biomed Biotechnol. 2006;2006(4):69616.
Encoded by the genome of most eukaryotes examined so far, microRNAs (miRNAs) are small ~21-nucleotide (nt) noncoding RNAs (ncRNAs) derived from a biosynthetic cascade involving sequential processing steps executed by the ribonucleases (RNases) III Drosha and Dicer. Following their recent identification, miRNAs have rapidly taken the center stage as key regulators of gene expression. In this review, we will summarize our current knowledge of the miRNA biosynthetic pathway and its protein components, as well as the processes it regulates via miRNAs, which are known to exert a variety of biological functions in eukaryotes. Although the relative importance of miRNAs remains to be fully appreciated, deregulated protein expression resulting from either dysfunctional miRNA biogenesis or abnormal miRNA-based gene regulation may represent a key etiologic factor in several, as yet unidentified, diseases. Hence is our need to better understand the complexity of the basic mechanisms underlying miRNA biogenesis and function. [Abstract/Link to Full Text]

Ui-Tei K, Naito Y, Saigo K
Essential Notes Regarding the Design of Functional siRNAs for Efficient Mammalian RNAi.
J Biomed Biotechnol. 2006;2006(4):65052.
Short interfering RNAs (siRNAs) are widely used to bring about RNA interference (RNAi) in mammalian cells. Numerous siRNAs may be designed for any target gene though most of which would be incapable of efficiently inducing mammalian RNAi. Certain highly functional siRNAs designed for knockout of a particular gene may render unrelated endogenous genes nonfunctional. These major bottlenecks should be properly eliminated when RNAi technologies are employed for any experiment in mammalian functional genomics. This paper thus presents essential notes and findings regarding the proper choice of siRNA-sequence selection algorithms and web-based online software systems. [Abstract/Link to Full Text]

Plante I, Davidovic L, Ouellet DL, Gobeil LA, Tremblay S, Khandjian EW, Provost P
Dicer-Derived MicroRNAs Are Utilized by the Fragile X Mental Retardation Protein for Assembly on Target RNAs.
J Biomed Biotechnol. 2006;2006(4):64347.
In mammalian cells, fragile X mental retardation protein (FMRP) has been reported to be part of a microRNA (miRNA)-containing effector ribonucleoprotien (RNP) complex believed to mediate translational control of specific mRNAs. Here, using recombinant proteins, we demonstrate that human FMRP can act as a miRNA acceptor protein for the ribonuclease Dicer and facilitate the assembly of miRNAs on specific target RNA sequences. The miRNA assembler property of FMRP was abrogated upon deletion of its single-stranded (ss) RNA binding K-homology domains. The requirement of FMRP for efficient RNA interference (RNAi) in vivo was unveiled by reporter gene silencing assays using various small RNA inducers, which also supports its involvement in an ss small interfering RNA (siRNA)-containing RNP (siRNP) effector complex in mammalian cells. Our results define a possible role for FMRP in RNA silencing and may provide further insight into the molecular defects in patients with the fragile X syndrome. [Abstract/Link to Full Text]

Oliveira S, Storm G, Schiffelers RM
Targeted Delivery of siRNA.
J Biomed Biotechnol. 2006;2006(4):63675.
Therapeutic application of siRNA requires delivery to the correct intracellular location, to interact with the RNAi machinery within the target cell, within the target tissue responsible for the pathology. Each of these levels of targeting poses a significant barrier. To overcome these barriers several strategies have been developed, such as chemical modifications of siRNA, viral nucleic acid delivery systems, and nonviral nucleic acid delivery systems. Here, we discuss progress that has been made to improve targeted delivery of siRNA in vivo for each of these strategies. [Abstract/Link to Full Text]

Clark J, Ding S
Generation of RNAi Libraries for High-Throughput Screens.
J Biomed Biotechnol. 2006;2006(4):45716.
The completion of the genome sequencing for several organisms has created a great demand for genomic tools that can systematically analyze the growing wealth of data. In contrast to the classical reverse genetics approach of creating specific knockout cell lines or animals that is time-consuming and expensive, RNA-mediated interference (RNAi) has emerged as a fast, simple, and cost-effective technique for gene knockdown in large scale. Since its discovery as a gene silencing response to double-stranded RNA (dsRNA) with homology to endogenous genes in Caenorhabditis elegans (C elegans), RNAi technology has been adapted to various high-throughput screens (HTS) for genome-wide loss-of-function (LOF) analysis. Biochemical insights into the endogenous mechanism of RNAi have led to advances in RNAi methodology including RNAi molecule synthesis, delivery, and sequence design. In this article, we will briefly review these various RNAi library designs and discuss the benefits and drawbacks of each library strategy. [Abstract/Link to Full Text]

Sun L, Gao H, Sarma VJ, Guo RF, Ward PA
Adenovirus-Mediated In Vivo Silencing of Anaphylatoxin Receptor C5aR.
J Biomed Biotechnol. 2006;2006(4):28945.
C5a, one of the most potent inflammatory peptides, induces its inflammatory functions by interacting with C5a receptor (C5aR) that belongs to the rhodopsin family of seven-transmembrane G protein-coupled receptors. C5a/C5aR signaling has been implicated in the pathogenesis of many inflammatory and immunological diseases such as sepsis and acute lung injury. Widespread upregulation of C5aR has been seen at both the protein level and transcriptional level under pathological conditions. Here, we show that C5aR gene expression can be specifically suppressed by siRNA, both in vitro and in vivo. A panel of chemically siRNA oligonucleotides was first synthesized to identify the functional siRNA sequences. The short hairpin RNAs (shRNAs) were also designed, cloned, and tested for the silencing effects in C5aR transfected cells. The effective shRNA expression cassettes were then transferred to an adenovirus DNA vector. ShRNA-expressing adenoviruses were intratracheally administered into mouse lung, and a significant in vivo silencing of C5aR was obtained four days after administration. Thus, C5aR shRNA-expressing adenoviruses appear to be an alternative strategy for the treatment of complement-induced disorders. [Abstract/Link to Full Text]

Lin SL, Miller JD, Ying SY
Intronic MicroRNA (miRNA).
J Biomed Biotechnol. 2006;2006(4):26818.
Nearly 97% of the human genome is composed of noncoding DNA, which varies from one species to another. Changes in these sequences often manifest themselves in clinical and circumstantial malfunction. Numerous genes in these non-protein-coding regions encode microRNAs, which are responsible for RNA-mediated gene silencing through RNA interference (RNAi)-like pathways. MicroRNAs (miRNAs), small single-stranded regulatory RNAs capable of interfering with intracellular messenger RNAs (mRNAs) with complete or partial complementarity, are useful for the design of new therapies against cancer polymorphisms and viral mutations. Currently, many varieties of miRNA are widely reported in plants, animals, and even microbes. Intron-derived microRNA (Id-miRNA) is a new class of miRNA derived from the processing of gene introns. The intronic miRNA requires type-II RNA polymerases (Pol-II) and spliceosomal components for their biogenesis. Several kinds of Id-miRNA have been identified in C elegans, mouse, and human cells; however, neither function nor application has been reported. Here, we show for the first time that intron-derived miRNAs are able to induce RNA interference in not only human and mouse cells, but in also zebrafish, chicken embryos, and adult mice, demonstrating the evolutionary preservation of intron-mediated gene silencing via functional miRNA in cell and in vivo. These findings suggest an intracellular miRNA-mediated gene regulatory system, fine-tuning the degradation of protein-coding messenger RNAs. [Abstract/Link to Full Text]

Sioud M, Furset G
Molecular Basis for the Immunostimulatory Potency of Small Interfering RNAs.
J Biomed Biotechnol. 2006;2006(4):23429.
Small interfering RNAs (siRNAs) represent a new class of antigene agents, which has emerged as a powerful tool for functional genomics and might serve as a potent therapeutic approach. However, several studies have showed that they could trigger several bystander effects, including immune activation and inhibition of unintended target genes. Although activation of innate immunity by siRNAs might be beneficial for therapy in some instances, uncontrolled activation can be toxic, and is therefore a major challenging problem. Interestingly, replacement of uridines in siRNA sequences with their 2'-modified counterparts abrogated siRNA bystander effects. Here we highlight these important findings that are expected to facilitate the rational design of siRNAs that avoid the induction of bystander effects. [Abstract/Link to Full Text]

O'shea KS, De Boer LS, Slawny NA, Gratsch TE
Transplacental RNAi: Deciphering Gene Function in the Postimplantation-Staged Embryo.
J Biomed Biotechnol. 2006;2006(4):18657.
RNAi offers the opportunity to examine the role in postimplantation development of genes that cause preimplantation lethality and to create allelic series of targeted embryos. We have delivered constituitively expressed short hairpin (sh) RNAs to pregnant mice during the early postimplantation period of development and observed gene knockdown and defects that phenocopy the null embryo. We have silenced genes that have not yet been "knocked out" in the mouse (geminin and Wnt8b), those required during earlier cleavage stages of development (nanog), and genes required at implantation (Bmp4, Bmp7) singly and in combination (Bmp4 + Bmp7), and obtained unique phenotypes. We have also determined a role in postimplantation development of two transcripts identified in a differential display RT-PCR screen of genes induced in ES cells by noggin exposure, Aggf1 and an Est (GenBank AK008955). Systemic delivery of shRNAs provides a valuable approach to gene silencing in the embryo. [Abstract/Link to Full Text]

Plante I, Provost P
Hypothesis: A Role for Fragile X Mental Retardation Protein in Mediating and Relieving MicroRNA-Guided Translational Repression?
J Biomed Biotechnol. 2006;2006(4):16806.
MicroRNA (miRNA)-guided messenger RNA (mRNA) translational repression is believed to be mediated by effector miRNA-containing ribonucleoprotein (miRNP) complexes harboring fragile X mental retardation protein (FMRP). Recent studies documented the nucleic acid chaperone properties of FMRP and characterized its role and importance in RNA silencing in mammalian cells. We propose a model in which FMRP could facilitate miRNA assembly on target mRNAs in a process involving recognition of G quartet structures. Functioning within a duplex miRNP, FMRP may also mediate mRNA targeting through a strand exchange mechanism, in which the miRNA* of the duplex is swapped for the mRNA. Furthermore, FMRP may contribute to the relief of miRNA-guided mRNA repression through a reverse strand exchange reaction, possibly initiated by a specific cellular signal, that would liberate the mRNA for translation. Suboptimal utilization of miRNAs may thus account for some of themolecular defects in patients with the fragile X syndrome. [Abstract/Link to Full Text]

Nunomura A, Honda K, Takeda A, Hirai K, Zhu X, Smith MA, Perry G
Oxidative damage to RNA in neurodegenerative diseases.
J Biomed Biotechnol. 2006;2006(3):82323.
Since 1999, oxidative damage to RNA molecules has been described in several neurological diseases including Alzheimer's disease, Parkinson's disease, Down syndrome, dementia with Lewy bodies, prion disease, subacute sclerosing panencephalitis, and xeroderma pigmentosum. An early involvement of RNA oxidation of vulnerable neuronal population in the neurodegenerative diseases has been demonstrated, which is strongly supported by a recent observation of increased RNA oxidation in brains of subjects with mild cognitive impairment. Until recently, little is known about consequences and cellular handling of the RNA damage. However, increasing body of evidence suggests detrimental effects of the RNA damage in protein synthesis and the existence of several coping mechanisms including direct repair and avoiding the incorporation of the damaged ribonucleotides into translational machinery. Further investigations toward understanding of the consequences and cellular handling mechanisms of the oxidative RNA damage may provide significant insights into the pathogenesis and therapeutic strategies of the neurodegenerative diseases. [Abstract/Link to Full Text]

Hruska KS, Goker-Alpan O, Sidransky E
Gaucher disease and the synucleinopathies.
J Biomed Biotechnol. 2006;2006(3):78549.
Several recent observations suggest a connection between Gaucher disease, the inherited deficiency of glucocerebrosidase, and the synucleinopathies. Rare patients have been observed who develop both Gaucher disease and parkinsonism. Autopsy studies on these subjects reveal synuclein-positive Lewy bodies and inclusions. An increased incidence of synucleinopathies also has been noted in relatives of Gaucher probands. In complementary studies, screening of patients with parkinsonism has identified a greater than expected frequency of glucocerebrosidase mutations. These glucocerebrosidase mutation carriers have a wide spectrum of associated parkinsonian phenotypes, ranging from classic L-dopa-responsive Parkinson disease to a phenotype more characteristic of Lewy body dementia. Despite this association, the vast majority of Gaucher carriers and patients with Gaucher disease never develop parkinsonism. However, mutations in this gene are likely to be a contributing risk factor in subjects otherwise prone to developing synucleinopathies. [Abstract/Link to Full Text]

Avila J, Santa-María I, Pérez M, Hernández F, Moreno F
Tau phosphorylation, aggregation, and cell toxicity.
J Biomed Biotechnol. 2006;2006(3):74539.
Protein aggregation takes place in many neurodegenerative disorders. However, there is a controversy about the possible toxicity of these protein aggregates. In this review, this controversy is discussed, focussing on the tau aggregation that takes place in those disorders known as tauopathies. [Abstract/Link to Full Text]

Rojo L, Sjöberg MK, Hernández P, Zambrano C, Maccioni RB
Roles of cholesterol and lipids in the etiopathogenesis of Alzheimer's disease.
J Biomed Biotechnol. 2006;2006(3):73976.
Alzheimer's disease is the principal cause of dementia throughout the world and the fourth cause of death in developed economies.This brain disorder is characterized by the formation of brain protein aggregates, namely, the paired helical filaments and senile plaques. Oxidative stress during life, neuroinflamamtion, and alterations in neuron-glia interaction patterns have been also involved in the etiopathogenesis of this disease. In recent years, cumulative evidence has been gained on the involvement of alteration in neuronal lipoproteins activity, as well as on the role of cholesterol and other lipids in the pathogenesis of this neurodegenerative disorder. In this review, we analyze the links between changes in cholesterol homeostasis, and the changes of lipids of major importance for neuronal activity and Alheimer's disease. The investigation on the fine molecular mechanisms underlying the lipids influence in the etiopathogenesis of Alzheimer's disease may shed light into its treatment and medical management. [Abstract/Link to Full Text]

Doherty JD
Screening pesticides for neuropathogenicity.
J Biomed Biotechnol. 2006;2006(3):70414.
Pesticides are routinely screened in studies that follow specific guidelines for possible neuropathogenicity in laboratory animals. These tests will detect chemicals that are by themselves strong inducers of neuropathogenesis if the tested strain is susceptible relative to the time of administration and methodology of assessment. Organophosphate induced delayed neuropathy (OPIDN) is the only known human neurodegenerative disease associated with pesticides and the existing study guidelines with hens are a standard for predicting the potential for organophosphates to cause OPIDN. Although recent data have led to the suggestion that pesticides may be risk factors for Parkinsonism syndrome, there are no specific protocols to evaluate this syndrome in the existing study guidelines. Ideally additional animal models for human neurodegenerative diseases need to be developed and incorporated into the guidelines to further assure the public that limited exposure to pesticides is not a risk factor for neurodegenerative diseases. [Abstract/Link to Full Text]

Wallace DR
HIV Neurotoxicity: Potential Therapeutic Interventions.
J Biomed Biotechnol. 2006;2006(3):65741.
Individuals suffering from human immunodeficiency virus type 1 (HIV-1) infection suffer from a wide range of neurological deficits. The most pronounced are the motor and cognitive deficits observed in many patients in the latter stages of HIV infection. Gross postmortem inspection shows cortical atrophy and widespread neuronal loss. One of the more debilitating of the HIV-related syndromes is AIDS-related dementia, or HAD. Complete understanding of HIV neurotoxicity has been elusive. Both direct and indirect toxic mechanisms have been implicated in the neurotoxicity of the HIV proteins, Tat and gp120. The glutamatergic system, nitric oxide, calcium, oxidative stress, apoptosis, and microglia have all been implicated in the pathogenesis of HIV-related neuronal degeneration. The aim of this review is to summarize the most recent work and provide an overview to the current theories of HIV-related neurotoxicity and potential avenues of therapeutic interventions to prevent the neuronal loss and motor/cognitive deficits previously described. [Abstract/Link to Full Text]

Wooten MW, Hu X, Babu JR, Seibenhener ML, Geetha T, Paine MG, Wooten MC
Signaling, Polyubiquitination, Trafficking, and Inclusions: Sequestosome 1/p62's Role in Neurodegenerative Disease.
J Biomed Biotechnol. 2006;2006(3):62079.
Aggregated misfolded proteins are hallmarks of most neurodegenerative diseases. In a chronic disease state, including pathologic situations of oxidative stress, these proteins are sequestered into inclusions. Accumulation of aggregated proteins can be prevented by chaperones, or by targeting their degradation to the UPS. If the accumulation of these proteins exceeds their degradation, they may impair the function of the proteasome. Alternatively, the function of the proteasome may be preserved by directing aggregated proteins to the autophagy-lysosome pathway for degradation. Sequestosome 1/p62 has recently been shown to interact with polyubiquitinated proteins through its UBA domain and may direct proteins to either the UPS or autophagosome. P62 is present in neuronal inclusions of individuals with Alzheimer's disease and other neurodegenerative diseases. Herein, we review p62's role in signaling, aggregation, and inclusion formation, and specifically as a possible contributor to Alzheimer's disease. The use of p62 as a potential target for the development of therapeutics and as a disease biomarker is also discussed. [Abstract/Link to Full Text]

Wang DS, Dickson DW, Malter JS
beta-Amyloid Degradation and Alzheimer's Disease.
J Biomed Biotechnol. 2006;2006(3):58406.
Extensive beta-amyloid (A beta) deposits in brain parenchyma in the form of senile plaques and in blood vessels in the form of amyloid angiopathy are pathological hallmarks of Alzheimer's disease (AD). The mechanisms underlying A beta deposition remain unclear. Major efforts have focused on A beta production, but there is little to suggest that increased production of A beta plays a role in A beta deposition, except for rare familial forms of AD. Thus, other mechanisms must be involved in the accumulation of A beta in AD. Recent data shows that impaired clearance may play an important role in A beta accumulation in the pathogenesis of AD. This review focuses on our current knowledge of A beta-degrading enzymes, including neprilysin (NEP), endothelin-converting enzyme (ECE), insulin-degrading enzyme (IDE), angiotensin-converting enzyme (ACE), and the plasmin/uPA/tPA system as they relate to amyloid deposition in AD. [Abstract/Link to Full Text]

Smith MA, Perry G, Zhu X, Haoudi A
Neurodegenerative diseases: mechanisms and therapies.
J Biomed Biotechnol. 2006;2006(3):47539. [Abstract/Link to Full Text]

Casadesus G, Puig ER, Webber KM, Atwood CS, Escuer MC, Bowen RL, Perry G, Smith MA
Targeting gonadotropins: an alternative option for Alzheimer disease treatment.
J Biomed Biotechnol. 2006;2006(3):39508.
Recent evidence indicates that, alongside oxidative stress, dysregulation of the cell cycle in neurons susceptible to degeneration in Alzheimer disease may play a crucial role in the initiation of the disease. As such, the role of reproductive hormones, which are closely associated with the cell cycle both during development and after birth, may be of key import. While estrogen has been the primary focus, the protective effects of hormone replacement therapy on cognition and dementia only during a crucial period led us to expand the study of hormonal influences to other members of the hypothalamic pituitary axis. Specifically, in this review, we focus on luteinizing hormone, which is not only increased in the sera of patients with Alzheimer disease but, like estrogen, is modulated by hormone replacement therapy and also influences cognitive behavior and pathogenic processing in animal models of the disease. Targeting gonadotropins may be a useful treatment strategy for disease targeting multiple pleiotropic downstream consequences. [Abstract/Link to Full Text]

Bürklen TS, Schlattner U, Homayouni R, Gough K, Rak M, Szeghalmi A, Wallimann T
The Creatine Kinase/Creatine Connection to Alzheimer's Disease: CK-Inactivation, APP-CK Complexes and Focal Creatine Deposits.
J Biomed Biotechnol. 2006;2006(3):35936.
Cytosolic brain-type creatine kinase (BB-CK), which is coexpressed with ubiquitous mitochondrial uMtCK, is significantly inactivated by oxidation, in Alzheimer's disease (AD) patients. Since CK has been shown to play a fundamental role in cellular energetics of the brain, any disturbance of this enzyme may exasperate the AD disease process. Mutations in amyloid precursor protein (APP) are associated with early onset AD and result in abnormal processing of APP, and accumulation of A beta peptide, the main constituent of amyloid plaques in AD brain. Recent data on a direct interaction between APP and the precursor of uMtCK support an emerging relationship between AD, cellular energy levels and mitochondrial function. In addition, recently discovered creatine (Cr) deposits in the brain of transgenic AD mice, as well as in the hippocampus from AD patients, indicate a direct link between perturbed energy state, Cr metabolism and AD. Here, we review the roles of Cr and Cr-related enzymes and consider the potential value of supplementation with Cr, a potent neuroprotective substance. As a hypothesis, we consider whether Cr, if given at an early time point of the disease, may prevent or delay the course of AD-related neurodegeneration. [Abstract/Link to Full Text]

Gong CX, Liu F, Grundke-Iqbal I, Iqbal K
Dysregulation of protein phosphorylation/dephosphorylation in Alzheimer's disease: a therapeutic target.
J Biomed Biotechnol. 2006;2006(3):31825.
Studies during the last two decades have provided new insights into the molecular mechanism of Alzheimer's disease (AD). One of the milestone findings in AD research was the demonstration that neurofibrillary degeneration characterized by tau pathology is central to the pathogenesis of AD and other tauopathies and that abnormal hyperphosphorylation of tau is pivotal to neurofibrillary degeneration. This article reviews the recent research advances in tau pathology and the underlying dysregulation of the protein phosphorylation/dephosphorylation system. An updated model of the mechanism of neurofibrillary degeneration is also presented, and a promising therapeutic target to treat AD by correcting dysregulation of protein phosphorylation/dephosphorylation is discussed. [Abstract/Link to Full Text]

Reddy PH
Mitochondrial oxidative damage in aging and Alzheimer's disease: implications for mitochondrially targeted antioxidant therapeutics.
J Biomed Biotechnol. 2006;2006(3):31372.
The overall aim of this article is to review current therapeutic strategies for treating AD, with a focus on mitochondrially targeted antioxidant treatments. Recent advances in molecular, cellular, and animal model studies of AD have revealed that amyloid precursor protein derivatives, including amyloid beta (A beta) monomers and oligomers, are likely key factors in tau hyperphosphorylation, mitochondrial oxidative damage, inflammatory changes, and synaptic failure in the brain tissue of AD patients. Several therapeutic strategies have been developed to treat AD, including anti-inflammatory, antioxidant, and antiamyloid approaches. Among these, mitochondrial antioxidant therapy has been found to be the most efficacious in reducing pathological changes and in not producing adverse effects; thus, mitochondrial antioxidant therapy is promising as a treatment for AD patients. However, a major limitation in applying mitochondrial antioxidants to AD treatment has been the inability of researchers to enhance antioxidant levels in mitochondria. Recently, however, there has been a breakthrough. Researchers have recently been able to promote the entry of certain antioxidants-including MitoQ, MitoVitE, MitoPBN, MitoPeroxidase, and amino acid and peptide-based SS tetrapeptides-into mitochondria, several hundred-fold more than do natural antioxidants. Once in the mitochondria, they rapidly neutralize free radicals and decrease mitochondrial toxicity. Thus, mitochondrially targeted antioxidants are promising candidates for treating AD patients. [Abstract/Link to Full Text]

Corder EH, Mellick GD
Parkinson's disease in relation to pesticide exposure and nuclear encoded mitochondrial complex I gene variants.
J Biomed Biotechnol. 2006;2006(3):27601.
Parkinson's disease (PD) is a common age-related neurodegenerative disorder thought to result from the integrated effects of genetic background and exposure to neuronal toxins. Certain individual nuclear-encoded mitochondrial complex I gene polymorphisms were found to be associated with ~ 2-fold risk variation in an Australian case-control sample. We further characterized this sample of 306 cases and 321 controls to determine the mutual information contained in the 22 SNPs and, additionally, level of pesticide exposure: five distinct risk sets were identified using grade-of-membership analysis. Of these, one was robust to pesticide exposure (I), three were vulnerable (II, III, IV), and another (V) denoted low risk for unexposed persons. Risk for individual subjects varied > 16-fold according to level of membership in the vulnerable groups. We conclude that inherited variation in mitochondrial complex I genes and pesticide exposure together modulate risk for PD. [Abstract/Link to Full Text]

Dwyer BE, Stone ML, Zhu X, Perry G, Smith MA
Heme deficiency in Alzheimer's disease: a possible connection to porphyria.
J Biomed Biotechnol. 2006;2006(3):24038.
Mechanisms that cause Alzheimer's disease (AD), an invariably fatal neurodegenerative disease, are unknown. Important recent data indicate that neuronal heme deficiency may contribute to AD pathogenesis. If true, factors that contribute to the intracellular heme deficiency could potentially alter the course of AD. The porphyrias are metabolic disorders characterized by enzyme deficiencies in the heme biosynthetic pathway. We hypothesize that AD may differ significantly in individuals possessing the genetic trait for an acute hepatic porphyria. We elaborate on this hypothesis and briefly review the characteristics of the acute hepatic porphyrias that may be relevant to AD. We note the proximity of genes encoding enzymes of the heme biosynthesis pathway to genetic loci linked to sporadic, late-onset AD. In addition, we suggest that identification of individuals carrying the genetic trait for acute porphyria may provide a unique resource for investigating AD pathogenesis and inform treatment and management decisions. [Abstract/Link to Full Text]

Takeda A, Hasegawa T, Matsuzaki-Kobayashi M, Sugeno N, Kikuchi A, Itoyama Y, Furukawa K
Mechanisms of neuronal death in synucleinopathy.
J Biomed Biotechnol. 2006;2006(3):19365.
alpha-synuclein is a key molecule in the pathogenesis of synucleinopathy including Parkinson's disease and multiple system atrophy. In this mini-review, we mainly focus on recent data obtained from cellular models of synucleinopathy and discuss the possible mechanisms of neurodegeneration. Recent progress suggests that the aggregate formation of alpha-synuclein is cytoprotective and that its precursor oligomer (protofibril) may be cytotoxic. The catechol-derived quinones are the candidate molecules that facilitate the oligomer formation of alpha-synuclein. Furthermore, the cellular membranes are shown to be the primary targets injured by mutant alpha-synucleins, and the mitochondrial dysfunction seems to be an initial step in the neuronal death. [Abstract/Link to Full Text]

---

Recent Articles in BMC Biotechnology

---

Cox MM, Layton SL, Jiang T, Cole K, Hargis BM, Berghman LR, Bottje WG, Kwon YM
Scarless and site-directed mutagenesis in Salmonella enteritidis chromosome.
BMC Biotechnol. 2007;759.
BACKGROUND: A variety of techniques have been described which introduce scarless, site-specific chromosomal mutations. These techniques can be applied to make point mutations or gene deletions as well as insert heterologous DNA into bacterial vectors for vaccine development. Most methods use a multi-step approach that requires cloning and/or designing repeat sequences to facilitate homologous recombination. We have modified previously published techniques to develop a simple, efficient PCR-based method for scarless insertion of DNA into Salmonella enteritidis chromosome. RESULTS: The final product of this mutation strategy is the insertion of DNA encoding a foreign epitope into the S. enteritidis genome without the addition of any unwanted sequence. This experiment was performed by a two-step mutation process via PCR fragments, Red recombinase and counter-selection with the I-SceI enzyme site. First, the I-SceI site and kanamycin resistance gene were introduced into the genome of cells expressing Red recombinase enzymes. Next, this sequence was replaced by a chosen insertion sequence. DNA fragments used for recombination were linear PCR products which consisted of the foreign insertion sequence flanked by homologous sequences of the target gene. Described herein is the insertion of a section of the M2e epitope (LM2) of Influenza A virus, a domain of CD154 (CD154s) or a combination of both into the outer membrane protein LamB of S. enteritidis. CONCLUSION: We have successfully used this method to produce multiple mutants with no antibiotic gene on the genome or extra sequence except those nucleotides required for expression of epitope regions. This method is advantageous over other protocols in that it does not require cloning or creating extra duplicate regions to facilitate homologous recombination, contains a universal construct in which an epitope of choice can be placed to check for cell surface expression, and shows high efficiency when screening for positive mutants. Other opportunities of this mutational strategy include creating attenuated mutants and site-specific, chromosomal deletion mutations. Furthermore, this method should be applicable in other gram-negative bacterial species where Red recombinase enzymes can be functionally expressed. [Abstract/Link to Full Text]

Hultberg A, Tremblay DM, de Haard H, Verrips T, Moineau S, Hammarström L, Marcotte H
Lactobacillli expressing llama VHH fragments neutralise Lactococcus phages.
BMC Biotechnol. 2007;758.
BACKGROUND: Bacteriophages infecting lactic acid bacteria (LAB) are widely acknowledged as the main cause of milk fermentation failures. In this study, we describe the surface-expression as well as the secretion of two functional llama heavy-chain antibody fragments, one binding to the major capsid protein (MCP) and the other to the receptor-binding proteins (RBP) of the lactococcal bacteriophage p2, by lactobacilli in order to neutralise lactococcal phages. RESULTS: The antibody fragment VHH5 that is directed against the RBP, was fused to a c-myc tag and expressed in a secreted form by a Lactobacillus strain. The fragment VHH2 that is binding to the MCP, was fused to an E-tag and anchored on the surface of the lactobacilli. Surface expression of VHH2 was confirmed by flow cytometry using an anti-E-tag antibody. Efficient binding of both the VHH2 and the secreted VHH5 fragment to the phage antigens was shown in ELISA. Scanning electron microscopy showed that lactobacilli expressing VHH2 anchored at their surface were able to bind lactococcal phages. A neutralisation assay also confirmed that the secreted VHH5 and the anchored VHH2 fragments prevented the adsorption of lactococcal phages to their host cells. CONCLUSION: Lactobacilli were able to express functional VHH fragments in both a secreted and a cell surface form and reduced phage infection of lactococcal cells. Lactobacilli expressing llama heavy-chain antibody fragments represent a novel way to limit phage infection. [Abstract/Link to Full Text]

Thompson KL, Pine PS, Rosenzweig BA, Turpaz Y, Retief J
Characterization of the effect of sample quality on high density oligonucleotide microarray data using progressively degraded rat liver RNA.
BMC Biotechnol. 2007;757.
BACKGROUND: The interpretability of microarray data can be affected by sample quality. To systematically explore how RNA quality affects microarray assay performance, a set of rat liver RNA samples with a progressive change in RNA integrity was generated by thawing frozen tissue or by ex vivo incubation of fresh tissue over a time course. RESULTS: Incubation of tissue at 37 degrees C for several hours had little effect on RNA integrity, but did induce changes in the transcript levels of stress response genes and immune cell markers. In contrast, thawing of tissue led to a rapid loss of RNA integrity. Probe sets identified as most sensitive to RNA degradation tended to be located more than 1000 nucleotides upstream of their transcription termini, similar to the positioning of control probe sets used to assess sample quality on Affymetrix GeneChip(R) arrays. Samples with RNA integrity numbers less than or equal to 7 showed a significant increase in false positives relative to undegraded liver RNA and a reduction in the detection of true positives among probe sets most sensitive to sample integrity for in silico modeled changes of 1.5-, 2-, and 4-fold. CONCLUSION: Although moderate levels of RNA degradation are tolerated by microarrays with 3'-biased probe selection designs, in this study we identify a threshold beyond which decreased specificity and sensitivity can be observed that closely correlates with average target length. These results highlight the value of annotating microarray data with metrics that capture important aspects of sample quality. [Abstract/Link to Full Text]

Kohl TO, Hitzeroth II, Christensen ND, Rybicki EP
Expression of HPV-11 L1 protein in transgenic Arabidopsis thaliana and Nicotiana tabacum.
BMC Biotechnol. 2007 Sep 12;7(1):56.
ABSTRACT: BACKGROUND: We investigated the possibility and feasibility of producing the human papillomavirus, HPV-11 L1 major capsid protein in transgenic Arabidopsis thaliana (A. thaliana) and Nicotiana tabacum (N. tabacum) as a potential source for an inexpensive subunit vaccine. RESULTS: Transformation of plants was only achieved with the HPV-11 L1 gene with the C-terminal nuclear localization signal (NLS-) encoding region removed and not with the full-length gene. The HPV-11 L1 NLS- gene was stably integrated and inherited through several generations of transgenic plants. Plant-derived HPV-11 L1 protein was capable of assembling into virus-like particles (VLPs), although resulting particles displayed a pleomorphic phenotype and appeared to encapsidate nucleic acid. Neutralising surface-linear and conformation-specific monoclonal antibodies were capable of binding the A. thaliana-derived particles. Although a lesser degree of binding was observed for the N. tabacum protein extract, the results suggest that plant-derived and insect cell-derived VLPs displayed similar antigenic properties. A yield of up to 12 ug/g of HPV-11 L1 NLS- protein was harvested from transgenic A. thaliana plants, whereas N. tabacum plants yielded 2.2 ug per gram of fresh leaf material - a significant increase over previous efforts. However, tobacco-produced L1 protein was significantly proteolysed. Immunization of New Zealand white rabbits with plant-derived extract containing approximately 50 ug of HPV-11 L1 NLS- protein induced an antibody response that predominantly recognized insect cell-produced HPV-11 L1 NLS- and not NLS+ VLPs. Evaluation of the same sera concluded that none of them were able to neutralise pseudovirus in vitro. CONCLUSION: We expressed the native HPV 11 L1 NLS- gene in two different plant species and showed that yields of HPV-11 L1 protein could be increased by between 500 and 1000-fold compared with previous reports. Inoculation of rabbits with plant extract from both types of plants resulted in a weak immune response, and antisera did not react with native HPV-11 L1 VLPs, nor did they neutralise HPV-11 pseudovirus infectivity. This has important implications for the production of HPV-11 vaccines in plants. [Abstract/Link to Full Text]

Mathys S, von Ah U, Lacroix C, Staub E, Mini R, Cereghetti T, Meile L
Detection of the pediocin gene pedA in strains from human faeces by real-time PCR and characterization of Pediococcus acidilactici UVA1.
BMC Biotechnol. 2007;755.
BACKGROUND: Bacteriocin-producing lactic acid bacteria are commonly used as natural protective cultures. Among them, strains of the genus Pediococcus are particularly interesting for their ability to produce pediocin, a broad spectrum antimicrobial peptide with a strong antagonistic activity against the food-borne pathogen Listeria monocytogenes. Furthermore, there is increasing interest in isolating new bacteriocin-producing strains of human intestinal origin that could be developed for probiotic effects and inhibition of pathogenic bacteria in the gut. In this work, we typed a new strain, co-isolated from baby faeces together with a Bifidobacterium thermophilum strain, and characterized its proteinaceous compound with strong antilisterial activity. RESULTS: The newly isolated strain UVA1 was identified as a Pediococcus acidilactici by carbohydrate fermentation profile, growth at 50 degrees C and 16S rDNA sequencing. The partially purified bacteriocin was heat resistant up to 100 degrees C, active over a wide range of pH (2 to 9) and susceptible to proteolytic enzymes. The molecular weight, estimated by SDS-PAGE, was similar to that of pediocin AcH/PA-1 (4.5 kDa). P. acidilactici UVA1 harboured a 9.5-kb plasmid that could be cured easily, which resulted in the loss of the antimicrobial activity. Southern hybridization using the DIG-labelled pedA-probe established that the bacteriocin gene was plasmid-borne as for all pediocin described so far. Nucleotide sequence of the whole operon (3.5 kb) showed almost 100 % similarity to the pediocin AcH/PA-1 operon. The mRNA transcript for pedA could be detected in P. acidilactici UVA1 but not in the cured derivative, confirming the expression of the pedA-gene in UVA1. Using a new real-time PCR assay, eleven out of seventeen human faecal samples tested were found to contain pedA-DNA. CONCLUSION: We identified and characterised the first pediocin produced by a human intestinal Pediococcus acidilactici isolate and successfully developed a new real-time PCR assay to show the large distribution of pedA-containing strains in baby faecal samples. [Abstract/Link to Full Text]

Cecchini DA, Serra I, Ubiali D, Terreni M, Albertini AM
New active site oriented glyoxyl-agarose derivatives of Escherichia coli penicillin G acylase.
BMC Biotechnol. 2007;754.
BACKGROUND: Immobilized Penicillin G Acylase (PGA) derivatives are biocatalysts that are industrially used for the hydrolysis of Penicillin G by fermentation and for the kinetically controlled synthesis of semi-synthetic beta-lactam antibiotics. One of the most used supports for immobilization is glyoxyl-activated agarose, which binds the protein by reacting through its superficial Lys residues. Since in E. coli PGA Lys are also present near the active site, an immobilization that occurs through these residues may negatively affect the performance of the biocatalyst due to the difficult diffusion of the substrate into the active site. A preferential orientation of the enzyme with the active site far from the support surface would be desirable to avoid this problem. RESULTS: Here we report how it is possible to induce a preferential orientation of the protein during the binding process on aldehyde activated supports. A superficial region of PGA, which is located on the opposite side of the active site, is enriched in its Lys content. The binding of the enzyme onto the support is consequently forced through the Lys rich region, thus leaving the active site fully accessible to the substrate. Different mutants with an increasing number of Lys have been designed and, when active, immobilized onto glyoxyl agarose. The synthetic performances of these new catalysts were compared with those of the immobilized wild-type (wt) PGA. Our results show that, while the synthetic performance of the wt PGA sensitively decreases after immobilization, the Lys enriched mutants have similar performances to the free enzyme even after immobilization. We also report the observations made with other mutants which were unable to undergo a successful maturation process for the production of active enzymes or which resulted toxic for the host cell. CONCLUSION: The desired orientation of immobilized PGA with the active site freely accessible can be obtained by increasing the density of Lys residues on a predetermined region of the enzyme. The newly designed biocatalysts display improved synthetic performances and are able to maintain a similar activity to the free enzymes. Finally, we found that the activity of the immobilized enzyme proportionally improves with the number of introduced Lys. [Abstract/Link to Full Text]

Basri M, Rahman RN, Ebrahimpour A, Salleh AB, Gunawan ER, Rahman MB
Comparison of estimation capabilities of response surface methodology (RSM) with artificial neural network (ANN) in lipase-catalyzed synthesis of palm-based wax ester.
BMC Biotechnol. 2007 Aug 30;7(1):53.
ABSTRACT: BACKGROUND: Wax esters are important ingredients in cosmetics, pharmaceuticals, lubricants and other chemical industries due to their excellent wetting property. Since the naturally occurring wax esters are expensive and scarce, these esters can be produced by enzymatic alcoholysis of vegetable oils. In an enzymatic reaction, study on modeling and optimization of the reaction system to increase the efficiency of the process is very important. The classical method of optimization involves varying one parameter at a time that ignores the combined interactions between physicochemical parameters. RSM is one of the most popular techniques used for optimization of chemical and biochemical processes and ANNs are powerful and flexible tools that are well suited to modeling biochemical processes. RESULTS: The coefficient of determination (R-squared) and absolute average deviation (AAD) values between the actual and estimated responses were determined as 1 and 0.002844 for ANN training set, 0.994122 and 1.289405 for ANN test set, and 0.999619 and 0.0256 for RSM training set respectively. The predicted optimum condition was: reaction time 7.38 h, temperature 53.9 degreesC, amount of enzyme 0.149 g, and substrate molar ratio 1:3.41. The actual experimental percentage yield was 84.6% at optimum condition, which compared well to the maximum predicted value by ANN (83.9%) and RSM (85.4%). The order of effective parameters on wax ester percentage yield were; respectively, time with 33.69%, temperature with 30.68%, amount of enzyme with 18.78% and substrate molar ratio with 16.85%, whereas R-squared and AAD were determined as 0.99998696 and 1.377 for ANN, and 0.99991515 and 3.131 for RSM respectively. CONCLUSIONS: Though both models provided good quality predictions in this study, yet the ANN showed a clear superiority over RSM for both data fitting and estimation capabilities. [Abstract/Link to Full Text]

Lindbo JA
High-efficiency protein expression in plants from agroinfection-compatible Tobacco mosaic virus expression vectors.
BMC Biotechnol. 2007;752.
BACKGROUND: Plants are increasingly being examined as alternative recombinant protein expression systems. Recombinant protein expression levels in plants from Tobacco mosaic virus (TMV)-based vectors are much higher than those possible from plant promoters. However the common TMV expression vectors are costly, and at times technically challenging, to work with. Therefore it was a goal to develop TMV expression vectors that express high levels of recombinant protein and are easier, more reliable, and more cost-effective to use. RESULTS: We have constructed a Cauliflower mosaic virus (CaMV) 35S promoter-driven TMV expression vector that can be delivered as a T-DNA to plant cells by Agrobacterium tumefaciens. Co-introduction (by agroinfiltration) of this T-DNA along with a 35S promoter driven gene for the RNA silencing suppressor P19, from Tomato bushy stunt virus (TBSV) resulted in essentially complete infection of the infiltrated plant tissue with the TMV vector by 4 days post infiltration (DPI). The TMV vector produced between 600 and 1200 micrograms of recombinant protein per gram of infiltrated tissue by 6 DPI. Similar levels of recombinant protein were detected in systemically infected plant tissue 10-14 DPI. These expression levels were 10 to 25 times higher than the most efficient 35S promoter driven transient expression systems described to date. CONCLUSION: These modifications to the TMV-based expression vector system have made TMV vectors an easier, more reliable and more cost-effective way to produce recombinant proteins in plants. These improvements should facilitate the production of recombinant proteins in plants for both research and product development purposes. The vector should be especially useful in high-throughput experiments. [Abstract/Link to Full Text]

Chin LT, Chu C, Chen HM, Hsu SC, Weng BC, Chu CH
Site-directed in vitro immunization leads to a complete human monoclonal IgG4 lambda that binds specifically to the CDR2 region of CTLA-4 (CD152) without interfering the engagement of natural ligands.
BMC Biotechnol. 2007;751.
BACKGROUND: The ability to acquire fully human monoclonal antibodies (mAbs) with pre-defined specificities is critical to the development of molecular tags for the analysis of receptor function in addition to promising immunotherapeutics. Yet most of the arriving affinity maturated and complete human immunoglobulin G (IgG) molecules, which are actually derived from single human B cells, have not widely been used to study the conserved self antigens (Ags) such as CD152 (cytotoxic T lymphocyte antigen-4, CTLA-4) because proper hosts are lacking. RESULTS: Here we developed an optimized protocol for site-directed in vitro immunizing peripheral blood mononuclear cells (PBMC) by using a selected epitope of human CD152, an essential receptor involved in down-regulation of T cell activation. The resultant stable trioma cell lines constantly produce anti-CD152 mAb (gamma4lambdahuCD152), which contains variable (V) regions of the heavy chain and the light chain derived from the VH3 and V lambda human germline genes, respectively, and yet displays an unusual IgG4 isotype. Interestingly, gamma4lambdahuCD152 has a basic pI not commonly found in myeloid monoclonal IgG4 lambdas as revealed by the isoelectric focusing (IEF) analysis. Furthermore, gamma4lambdahuCD152 binds specifically, with nanomolar affinity, to an extracellular constituency encompassing the putative second complementarity determining region (CDR2) of CD152, whereby it can react to activated CD3+ cells. CONCLUSION: In a context of specific cell depletion and conditioned medium,in vitro induction of human Abs against a conserved self Ag was successfully acquired and a relatively basic mAb, gamma4lambdahuCD152, with high affinity to CDR2 of CD152 was thus obtained. Application of such a human IgG4 lambda mAb with designated CDR2 specificity may impact upon and prefer for CD152 labeling both in situ and ex situ, as it does not affect the binding of endogenous B7 ligands and can localize into the confined immunological synapse which may otherwise prevent the access of whole IgG1 molecules. [Abstract/Link to Full Text]

Ali S, Shultz JL, Haq IU
High performance microbiological transformation of L-tyrosine to L-dopa by Yarrowia lipolytica NRRL-143.
BMC Biotechnol. 2007 Aug 16;7(1):50.
ABSTRACT: BACKGROUND: The 3,4-dihydroxy phenyl L-alanine (L-dopa) is a drug of choice for Parkinson's disease, controlling changes in energy metabolism enzymes of the myocardium following neurogenic injury. Aspergillus oryzae is commonly used for L-dopa production; however, potential improvements in ease of handling, growth rate and environmental impact have led to an interest in exploiting alternative yeasts. The two important elements required for L-dopa production are intracellular tyrosinases (thus pre-grown yeast cells are required for the transformation of L-tyrosine to L-dopa) and L-ascorbate, which acts as a reducing agent. RESULTS: Pre-grown cells of Yarrowia lipolytica NRRL-143 were used for the microbiological transformation of L-tyrosine to L-dopa. Different diatomite concentrations (0.5-3.0 mg/ml) were added to the acidic (pH 3.5) reaction mixture. Maximum L-dopa biosynthesis (2.96 mg/ml L-dopa from 2.68 mg/ml L-tyrosine) was obtained when 2.0 mg/ml diatomite was added 15 min after the start of the reaction. After optimizing reaction time (30 min), and yeast cell concentration (2.5 mg/ml), an overall 12.5 fold higher L-dopa production rate was observed when compared to the control. Significant enhancements in Yp/s, Qs and qs over the control were observed. CONCLUSION: Diatomite (2.0 mg/ml) addition 15 min after reaction commencement improved microbiological transformation of L-tyrosine to L-dopa (3.48 mg/ml; p[less than or equal to]0.05) by Y. lipolytica NRRL-143. A 35% higher substrate conversion rate was achieved when compared to the control. [Abstract/Link to Full Text]

Lohmann JS, Stougaard M, Koch J
A new enzymatic route for production of long 5'-phosphorylated oligonucleotides using suicide cassettes and rolling circle DNA synthesis.
BMC Biotechnol. 2007;749.
BACKGROUND: The quality of chemically synthesized oligonucleotides falls with the length of the oligonucleotide, not least due to depurinations and premature termination during production. This limits the use of long oligonucleotides in assays where long high-quality oligonucleotides are needed (e.g. padlock probes). Another problem with chemically synthesized oligonucleotides is that secondary structures contained within an oligonucleotide reduce the efficiency of HPLC and/or PAGE purification. Additionally, ligation of chemically synthesized oligonucleotides is less efficient than the ligation of enzymatically produced DNA molecules. RESULTS: Chemically synthesized oligonucleotides with hairpin structures were acquired from our standard supplier. The stem of the hairpin contained recognition sequences for the Nt. Alw I nicking enzyme and the Mly I restriction enzyme. These double stranded regions were positioned in a way to allow self-templated circularization of the oligonucleotide. Following ligation, tandem repeats of the complementary sequence of the circular oligonucleotide could be produced through rolling circle DNA synthesis. By running successive rounds of ligation, rolling circle DNA synthesis, and nicking, the original oligonucleotide could be amplified as either the (+)-strand or the (-)-strand. Alternatively, the hairpin structure could be removed by cleavage with the Mly I restriction enzyme, thereby releasing the oligonucleotide sequence contained within the hairpin structure from the hairpin. CONCLUSION: We present here a method for the enzymatic production through DNA amplification of oligonucleotides with freely designable 5'-ends and 3'-ends, using hairpin-containing self-templating oligonucleotides. The hairpin comprises recognition sequences for a nicking enzyme and a restriction enzyme. The oligonucleotides are amplified by successive rounds of ligation, rolling circle DNA synthesis and nicking. Furthermore, the hairpin can be removed by cleavage with the Mly I restriction enzyme. We have named such hairpin structures "suicide cassettes". [Abstract/Link to Full Text]

Nitsche A, Kurth A, Dunkhorst A, Pänke O, Sielaff H, Junge W, Muth D, Scheller F, Stöcklein W, Dahmen C, Pauli G, Kage A
One-step selection of Vaccinia virus-binding DNA aptamers by MonoLEX.
BMC Biotechnol. 2007;748.
BACKGROUND: As a new class of therapeutic and diagnostic reagents, more than fifteen years ago RNA and DNA aptamers were identified as binding molecules to numerous small compounds, proteins and rarely even to complete pathogen particles. Most aptamers were isolated from complex libraries of synthetic nucleic acids by a process termed SELEX based on several selection and amplification steps. Here we report the application of a new one-step selection method (MonoLEX) to acquire high-affinity DNA aptamers binding Vaccinia virus used as a model organism for complex target structures. RESULTS: The selection against complete Vaccinia virus particles resulted in a 64-base DNA aptamer specifically binding to orthopoxviruses as validated by dot blot analysis, Surface Plasmon Resonance, Fluorescence Correlation Spectroscopy and real-time PCR, following an aptamer blotting assay. The same oligonucleotide showed the ability to inhibit in vitro infection of Vaccinia virus and other orthopoxviruses in a concentration-dependent manner. CONCLUSION: The MonoLEX method is a straightforward procedure as demonstrated here for the identification of a high-affinity DNA aptamer binding Vaccinia virus. MonoLEX comprises a single affinity chromatography step, followed by subsequent physical segmentation of the affinity resin and a single final PCR amplification step of bound aptamers. Therefore, this procedure improves the selection of high affinity aptamers by reducing the competition between aptamers of different affinities during the PCR step, indicating an advantage for the single-round MonoLEX method. [Abstract/Link to Full Text]

Bassett CL, Callahan AM, Artlip TS, Scorza R, Srinivasan C
A minimal peach type II chlorophyll a/b-binding protein promoter retains tissue-specificity and light regulation in tomato.
BMC Biotechnol. 2007;747.
BACKGROUND: Promoters with tissue-specificity are desirable to drive expression of transgenes in crops to avoid accumulation of foreign proteins in edible tissues/organs. Several photosynthetic promoters have been shown to be strong regulators of expression of transgenes in light-responsive tissues and would be good candidates for leaf and immature fruit tissue-specificity, if expression in the mature fruit were minimized. RESULTS: A minimal peach chlorophyll a/b-binding protein gene (Lhcb2*Pp1) promoter (Cab19) was isolated and fused to an uidA (beta-glucuronidase [GUS]) gene containing the PIV2 intron. A control vector carrying an enhanced mas35S CaMV promoter fused to uidA was also constructed. Two different orientations of the Cab19::GUS fusion relative to the left T-DNA border of the binary vector were transformed into tomato. Ten independent regenerants of each construct and an untransformed control line were assessed both qualitatively and quantitatively for GUS expression in leaves, fruit and flowers, and quantitatively in roots. CONCLUSION: The minimal CAB19 promoter conferred GUS activity primarily in leaves and green fruit, as well as in response to light. GUS activity in the leaves of both Cab19 constructs averaged about 2/3 that observed with mas35S::GUS controls. Surprisingly, GUS activity in transgenic green fruit was considerably higher than leaves for all promoter constructs; however, in red, ripe fruit activities were much lower for the Cab19 promoter constructs than the mas35S::GUS. Although GUS activity was readily detectable in flowers and roots of mas35S::GUStransgenic plants, little activity was observed in plants carrying the Cab19 promoter constructs. In addition, the light-inducibility of the Cab19::GUS constructs indicated that all the requisite cis-elements for light responsiveness were contained on the Cab19 fragment. The minimal Cab19 promoter retains both tissue-specificity and light regulation and can be used to drive expression of foreign genes with minimal activity in mature, edible fruit. [Abstract/Link to Full Text]

Di Niro R, Ziller F, Florian F, Crovella S, Stebel M, Bestagno M, Burrone O, Bradbury AR, Secco P, Marzari R, Sblattero D
Construction of miniantibodies for the in vivo study of human autoimmune diseases in animal models.
BMC Biotechnol. 2007;746.
BACKGROUND: Phage display antibody libraries have been made from the lymphocytes of patients suffering from autoimmune diseases in which the antibodies are known to play a role in the pathogenesis or are important for the diagnosis of the disease. In the case of Celiac Disease, the immune response is directed against the autoantigen tissue transglutaminase. However, despite numerous studies, the role of these antibodies in the pathogenesis of this disease has not been elucidated. RESULTS: We were able to engineer specific anti-transglutaminase antibody fragments in the form called "miniantibody". These are produced by genetic fusion of anti-tTG scFv to Human, Mouse or Rat Fc domains, making them suitable for in vivo expression. The results obtained here indicate that the miniantibody molecule is efficiently secreted, and that the reactivity to the antigen is retained even after fusion to heterologous Fc domains. Further analysis demonstrate that the molecule is secreted as homodimeric, mimicking original antibody structure. Finally, the in vivo expression in mice leads to detectable serum levels with no apparent gross immune response by the host. CONCLUSION: In this work we demonstrated the usefulness of a method for the in vivo expression of miniantibodies specific to transglutaminase, corresponding to the autoimmune specificity of Celiac Disease. This can be proposed as a general method to study the pathogenic role of autoimmune antibodies in autoimmune diseases. [Abstract/Link to Full Text]

Chen Y, Qiu S, Luan CH, Luo M
Domain selection combined with improved cloning strategy for high throughput expression of higher eukaryotic proteins.
BMC Biotechnol. 2007;745.
BACKGROUND: Expression of higher eukaryotic genes as soluble, stable recombinant proteins is still a bottleneck step in biochemical and structural studies of novel proteins today. Correct identification of stable domains/fragments within the open reading frame (ORF), combined with proper cloning strategies, can greatly enhance the success rate when higher eukaryotic proteins are expressed as these domains/fragments. Furthermore, a HTP cloning pipeline incorporated with bioinformatics domain/fragment selection methods will be beneficial to studies of structure and function genomics/proteomics. RESULTS: With bioinformatics tools, we developed a domain/domain boundary prediction (DDBP) method, which was trained by available experimental data. Combined with an improved cloning strategy, DDBP had been applied to 57 proteins from C. elegans. Expression and purification results showed there was a 10-fold increase in terms of obtaining purified proteins. Based on the DDBP method, the improved GATEWAY cloning strategy and a robotic platform, we constructed a high throughput (HTP) cloning pipeline, including PCR primer design, PCR, BP reaction, transformation, plating, colony picking and entry clones extraction, which have been successfully applied to 90 C. elegans genes, 88 Brucella genes, and 188 human genes. More than 97% of the targeted genes were obtained as entry clones. This pipeline has a modular design and can adopt different operations for a variety of cloning/expression strategies. CONCLUSION: The DDBP method and improved cloning strategy were satisfactory. The cloning pipeline, combined with our recombinant protein HTP expression pipeline and the crystal screening robots, constitutes a complete platform for structure genomics/proteomics. This platform will increase the success rate of purification and crystallization dramatically and promote the further advancement of structure genomics/proteomics. [Abstract/Link to Full Text]

Negredo C, Monks E, Sweeney T
A novel real-time ultrasonic method for prion protein detection using plasminogen as a capture molecule.
BMC Biotechnol. 2007;743.
BACKGROUND: High resolution ultrasonography (HR-US) can monitor the molecular changes and biochemical interactions between proteins in real-time. The aim of this study was to use HR-US to characterize the real-time interactions between plasminogen coated beads and PrPSc and to determine if this approach could be applied to the identification of animals affected by prion diseases. Plasminogen, immobilized to beads, was used as a capturing tool for PrPSc in brain homogenates from scrapie affected sheep and the binding reaction was monitored in real-time in an ultrasonic cell. RESULTS: Changes in the ultrasonic parameters suggested that three processes occurred during the incubation: binding, protein-protein network formation and precipitation and that these processes occurred in a concentration dependent manner. Conversely, when homogenates from normal sheep were similarly examined, no evidence for the occurrence of these processes was found indicating the specificity of the interaction between the plasminogen coated beads and PrPSc. CONCLUSION: These results indicate firstly, that the plasminogen coated beads binded selectively to PrPSc and secondly, that a HR-US system can discriminate between scrapie affected and non-affected samples and thus has potential as a tool for the rapid diagnosis for prion diseases. This approach has the significant advantage of not requiring a proteinase K pre-digestion step, which is routinely used in current PrPSc detection assays. [Abstract/Link to Full Text]

Sutou S, Kunishi M, Kudo T, Wongsrikeao P, Miyagishi M, Otoi T
Knockdown of the bovine prion gene PRNP by RNA interference (RNAi) technology.
BMC Biotechnol. 2007;744.
BACKGROUND: Since prion gene-knockout mice do not contract prion diseases and animals in which production of prion protein (PrP) is reduced by half are resistant to the disease, we hypothesized that bovine animals with reduced PrP would be tolerant to BSE. Hence, attempts were made to produce bovine PRNP (bPRNP) that could be knocked down by RNA interference (RNAi) technology. Before an in vivo study, optimal conditions for knocking down bPRNP were determined in cultured mammalian cell systems. Factors examined included siRNA (short interfering RNA) expression plasmid vectors, target sites of PRNP, and lengths of siRNAs. RESULTS: Four siRNA expression plasmid vectors were used: three harboring different cloning sites were driven by the human U6 promoter (hU6), and one by the human tRNAVal promoter. Six target sites of bovine PRNP were designed using an algorithm. From 1 (22 mer) to 9 (19, 20, 21, 22, 23, 24, 25, 27, and 29 mer) siRNA expression vectors were constructed for each target site. As targets of siRNA, the entire bPRNP coding sequence was connected to the reporter gene of the fluorescent EGFP, or of firefly luciferase or Renilla luciferase. Target plasmid DNA was co-transfected with siRNA expression vector DNA into HeLaS3 cells, and fluorescence or luminescence was measured. The activities of siRNAs varied widely depending on the target sites, length of the siRNAs, and vectors used. Longer siRNAs were less effective, and 19 mer or 21 mer was generally optimal. Although 21 mer GGGGAGAACTTCACCGAAACT expressed by a hU6-driven plasmid with a Bsp MI cloning site was best under the present experimental conditions, the corresponding tRNA promoter-driven plasmid was almost equally useful. The effectiveness of this siRNA was confirmed by immunostaining and Western blotting. CONCLUSION: Four siRNA expression plasmid vectors, six target sites of bPRNP, and various lengths of siRNAs from 19 mer to 29 mer were examined to establish optimal conditions for knocking down of bPRNP in vitro. The most effective siRNA so far tested was 21 mer GGGGAGAACTTCACCGAAACT driven either by a hU6 or tRNA promoter, a finding that provides a basis for further studies in vivo. [Abstract/Link to Full Text]

Clark KJ, Carlson DF, Foster LK, Kong BW, Foster DN, Fahrenkrug SC
Enzymatic engineering of the porcine genome with transposons and recombinases.
BMC Biotechnol. 2007;742.
BACKGROUND: Swine is an important agricultural commodity and biomedical model. Manipulation of the pig genome provides opportunity to improve production efficiency, enhance disease resistance, and add value to swine products. Genetic engineering can also expand the utility of pigs for modeling human disease, developing clinical treatment methodologies, or donating tissues for xenotransplantation. Realizing the full potential of pig genetic engineering requires translation of the complete repertoire of genetic tools currently employed in smaller model organisms to practical use in pigs. RESULTS: Application of transposon and recombinase technologies for manipulation of the swine genome requires characterization of their activity in pig cells. We tested four transposon systems- Sleeping Beauty, Tol2, piggyBac, and Passport in cultured porcine cells. Transposons increased the efficiency of DNA integration up to 28-fold above background and provided for precise delivery of 1 to 15 transgenes per cell. Both Cre and Flp recombinase were functional in pig cells as measured by their ability to remove a positive-negative selection cassette from 16 independent clones and over 20 independent genomic locations. We also demonstrated a Cre-dependent genetic switch capable of eliminating an intervening positive-negative selection cassette and activating GFP expression from episomal and genome-resident transposons. CONCLUSION: We have demonstrated for the first time that transposons and recombinases are capable of mobilizing DNA into and out of the porcine genome in a precise and efficient manner. This study provides the basis for developing transposon and recombinase based tools for genetic engineering of the swine genome. [Abstract/Link to Full Text]

Pluta K, Diehl W, Zhang XY, Kutner R, Bialkowska A, Reiser J
Lentiviral vectors encoding tetracycline-dependent repressors and transactivators for reversible knockdown of gene expression: a comparative study.
BMC Biotechnol. 2007;741.
BACKGROUND: RNA interference (RNAi)-mediated by the expression of short hairpin RNAs (shRNAs) has emerged as a powerful experimental tool for reverse genetic studies in mammalian cells. A number of recent reports have described approaches allowing regulated production of shRNAs based on modified RNA polymerase II (Pol II) or RNA polymerase III (Pol III) promoters, controlled by drug-responsive transactivators or repressors such as tetracycline (Tet)-dependent transactivators and repressors. However, the usefulness of these approaches is often times limited, caused by inefficient delivery and/or expression of shRNA-encoding sequences in target cells and/or poor design of shRNAs sequences. With a view toward optimizing Tet-regulated shRNA expression in mammalian cells, we compared the capacity of a variety of hybrid Pol III promoters to express short shRNAs in target cells following lentivirus-mediated delivery of shRNA-encoding cassettes. RESULTS: RNAi-mediated knockdown of gene expression in target cells, controlled by a modified Tet-repressor (TetR) in the presence of doxycycline (Dox) was robust. Expression of shRNAs from engineered human U6 (hU6) promoters containing a single tetracycline operator (TO) sequence between the proximal sequence element (PSE) and the TATA box, or an improved second-generation Tet-responsive promoter element (TRE) placed upstream of the promoter was tight and reversible as judged using quantitative protein measurements. We also established and tested a novel hU6 promoter system in which the distal sequence element (DSE) of the hU6 promoter was replaced with a second-generation TRE. In this system, positive regulation of shRNA production is mediated by novel Tet-dependent transactivators bearing transactivation domains derived from the human Sp1 transcription factor. CONCLUSION: Our modified lentiviral vector system resulted in tight and reversible knockdown of target gene expression in unsorted cell populations. Tightly regulated target gene knockdown was observed with vectors containing either a single TO sequence or a second-generation TRE using carefully controlled transduction conditions. We expect these vectors to ultimately find applications for tight and reversible RNAi in mammalian cells in vivo. [Abstract/Link to Full Text]

Malone MH, Sciaky N, Stalheim L, Hahn KM, Linney E, Johnson GL
Laser-scanning velocimetry: a confocal microscopy method for quantitative measurement of cardiovascular performance in zebrafish embryos and larvae.
BMC Biotechnol. 2007;740.
BACKGROUND: The zebrafish Danio rerio is an important model system for drug discovery and to study cardiovascular development. Using a laser-scanning confocal microscope, we have developed a non-invasive method of measuring cardiac performance in zebrafish embryos and larvae that obtains cardiovascular parameters similar to those obtained using Doppler echocardiography in mammals. A laser scan line placed parallel to the path of blood in the dorsal aorta measures blood cell velocity, from which cardiac output and indices of vascular resistance and contractility are calculated. RESULTS: This technique, called laser-scanning velocimetry, was used to quantify the effects of pharmacological, developmental, and genetic modifiers of cardiac function. Laser-scanning velocimetry was applied to analyze the cardiovascular effects of morpholino knockdown of osmosensing scaffold for MEKK3 (OSM), which when mutated causes the human vascular disease cerebral cavernous malformations. OSM-deficient embryos had a constricted aortic arch and markedly increased peak cell velocity, a characteristic indicator of aortic stenosis. CONCLUSION: These data validate laser-scanning velocimetry as a quantitative tool to measure cardiovascular performance for pharmacological and genetic analysis in zebrafish, which requires no specialized equipment other than a laser-scanning confocal microscope. [Abstract/Link to Full Text]

Mena JA, Ramírez OT, Palomares LA
Population kinetics during simultaneous infection of insect cells with two different recombinant baculoviruses for the production of rotavirus-like particles.
BMC Biotechnol. 2007;739.
BACKGROUND: The simultaneous production of various recombinant proteins in every cell of a culture is often needed for the production of virus-like particles (VLP) or vectors for gene therapy. A common approach for such a purpose is the coinfection of insect cell cultures with different recombinant baculoviruses, each containing one or more recombinant genes. However, scarce information exists regarding kinetics during multiple infections, and to our knowledge, no studies are available on the behavior of the different populations that arise during coinfections. Such information is useful for designing infection strategies that maximize VLP or vector yield. In this work, kinetics of cell populations expressing rotavirus GFPVP2 (infected with bacGFPVP2), VP6 (infected with bacVP6), or both proteins simultaneously (coinfected with both baculoviruses) were followed by flow cytometry. RESULTS: In single infections, the population infected with any of the recombinant baculoviruses followed the Poisson distribution, as the population expressing a recombinant protein exhibited a hyperbolic-type function with respect to the multiplicity of infection (MOI) up to 5 pfu/cell. In coinfections, the population fraction expressing each recombinant protein could not be anticipated from results of single infections, as in some cases interference and synergistic effects were found. Only cultures with a total MOI below 5 pfu/cell followed the Poisson distribution. For cultures with a MOI of bacGFPVP2 above that of bacVP6 (overall MOI above 5 pfu/cell), the total population expressing one or both recombinant proteins was as low as 50% below that predicted by Poisson. In contrast, the population fraction expressing VP6 increased in coinfections, compared to that in single infections. The largest population fraction simultaneously expressing both recombinant proteins was 58%, and corresponded to cultures infected at a MOI of 5 and 1 pfu/cell of bacGFPVP2 and bacVP6, respectively. CONCLUSION: The infection conditions that maximize the cell population simultaneously expressing two recombinant proteins were determined. Such conditions could not have been anticipated from population kinetics in individual infections. This information should be taken into account for improved simultaneous production of various recombinant proteins in any work dealing with coinfections. [Abstract/Link to Full Text]

Flego M, Ascione A, Zamboni S, Dupuis ML, Imperiale V, Cianfriglia M
Generation of human scFvs antibodies recognizing a prion protein epitope expressed on the surface of human lymphoblastoid cells.
BMC Biotechnol. 2007;738.
BACKGROUND: A hallmark of prion disease is the transformation of normal cellular prion protein (PrPc) into an infectious disease-associated isoform, (PrPsc). Anti-prion protein monoclonal antibodies are invaluable for structure-function studies of PrP molecules. Furthermore recent in vitro and in vivo studies indicate that anti-PrP monoclonal antibodies can prevent the incorporation of PrPc into propagating prions. In the present article, we show two new human phage antibodies, isolated on recombinant hamster prion protein (rHaPrP). RESULTS: We adopted an antibody phage display strategy to isolate specific human antibodies directed towards rHaPrP which has been used as a bait for panning the synthetic ETH-2 antibody phage library. Two phage antibodies clones named MA3.B4 and MA3.G3 were isolated and characterized under genetic biochemical and immunocytochemical aspects. The clones were found to recognize the prion protein in ELISA studies. In flow-cytometry studies, these human single chain Fragment variable (scFv) phage-antibodies show a well defined pattern of reactivity on human lymphoblastoid and myeloid cells. CONCLUSION: Sequence analysis of the gene encoding for the antibody fragments and antigen recognition patterns determined by flow-cytometry analysis indicate that the isolated scFvs recognize novel epitopes in the PrPc molecule. These new anti PrPc human antibodies are unique reagents for prion protein detection and may represent a biologic platform to develop new reagents to treat PrPsc associated disease. [Abstract/Link to Full Text]

Souslova EA, Belousov VV, Lock JG, Strömblad S, Kasparov S, Bolshakov AP, Pinelis VG, Labas YA, Lukyanov S, Mayr LM, Chudakov DM
Single fluorescent protein-based Ca2+ sensors with increased dynamic range.
BMC Biotechnol. 2007;737.
BACKGROUND: Genetically encoded sensors developed on the basis of green fluorescent protein (GFP)-like proteins are becoming more and more popular instruments for monitoring cellular analytes and enzyme activities in living cells and transgenic organisms. In particular, a number of Ca2+ sensors have been developed, either based on FRET (Fluorescence Resonance Energy Transfer) changes between two GFP-mutants or on the change in fluorescence intensity of a single circularly permuted fluorescent protein (cpFP). RESULTS: Here we report significant progress on the development of the latter type of Ca2+ sensors. Derived from the knowledge of previously reported cpFP-based sensors, we generated a set of cpFP-based indicators with different spectral properties and fluorescent responses to changes in Ca2+ concentration. Two variants, named Case12 and Case16, were characterized by particular high brightness and superior dynamic range, up to 12-fold and 16.5-fold increase in green fluorescence between Ca2+-free and Ca2+-saturated forms. We demonstrated the high potential of these sensors on various examples, including monitoring of Ca2+ response to a prolonged glutamate treatment in cortical neurons. CONCLUSION: We believe that expanded dynamic range, high brightness and relatively high pH-stability should make Case12 and Case16 popular research tools both in scientific studies and high throughput screening assays. [Abstract/Link to Full Text]

Li J, Smyth P, Flavin R, Cahill S, Denning K, Aherne S, Guenther SM, O'Leary JJ, Sheils O
Comparison of miRNA expression patterns using total RNA extracted from matched samples of formalin-fixed paraffin-embedded (FFPE) cells and snap frozen cells.
BMC Biotechnol. 2007;736.
BACKGROUND: Archival formalin-fixed paraffin-embedded (FFPE) tissues have limited utility in applications involving analysis of gene expression due to mRNA degradation and modification during fixation and processing. This study analyzed 160 miRNAs in paired snap frozen and FFPE cells to investigate if miRNAs may be successfully detected in archival specimens. RESULTS: Our results show that miRNA extracted from FFPE blocks was successfully amplified using Q-RT-PCR. The levels of expression of miRNA detected in total RNA extracted from FFPE were higher than that extracted from snap frozen cells when the quantity of total RNA was identical. This phenomenon is most likely explained by the fact that larger numbers of FFPE cells were required to generate equivalent quantities of total RNA than their snap frozen counterparts. CONCLUSION: We hypothesise that methylol cross-links between RNA and protein which occur during tissue processing inhibit the yield of total RNA. However, small RNA molecules appear to be less affected by this process and are recovered more easily in the extraction process. In general miRNAs demonstrated reliable expression levels in FFPE compared with snap frozen paired samples, suggesting these molecules might prove to be robust targets amenable to detection in archival material in the molecular pathology setting. [Abstract/Link to Full Text]

Wulff H, Krieger T, Krüger K, Stahmer I, Thaiss F, Schäfer H, Block A
Cloning and characterization of an adenoviral vector for highly efficient and doxycycline-suppressible expression of bioactive human single-chain interleukin 12 in colon cancer.
BMC Biotechnol. 2007;735.
BACKGROUND: Interleukin-12 (IL-12) is well characterized to induce cellular antitumoral immunity by activation of NK-cells and T-lymphocytes. However, systemic administration of recombinant human IL-12 resulted in severe toxicity without perceptible therapeutic benefit. Even though intratumoral expression of IL-12 leads to tumor regression and long-term survival in a variety of animal models, clinical trials have not yet shown a significant therapeutic benefit. One major obstacle in the treatment with IL-12 is to overcome the relatively low expression of the therapeutic gene without compromising the safety of such an approach. Our objective was to generate an adenoviral vector system enabling the regulated expression of very high levels of bioactive, human IL-12. RESULTS: High gene expression was obtained utilizing the VP16 herpes simplex transactivator. Strong regulation of gene expression was realized by fusion of the VP16 to a tetracycline repressor with binding of the fusion protein to a flanking tetracycline operator and further enhanced by auto-regulated expression of its fusion gene within a bicistronic promoter construct. Infection of human colon cancer cells (HT29) at a multiplicity of infection (m.o.i.) of 10 resulted in the production of up to 8000 ng/106 cells in 48 h, thus exceeding any published vector system so far. Doxycycline concentrations as low as 30 ng/ml resulted in up to 5000-fold suppression, enabling significant reduction of gene expression in a possible clinical setting. Bioactivity of the human single-chain IL-12 was similar to purified human heterodimeric IL-12. Frozen sections of human colon cancer showed high expression of the coxsackie adenovirus receptor with significant production of human single chain IL-12 in colon cancer biopsies after infection with 3*107 p.f.u. Ad.3r-scIL12. Doxycycline mediated suppression of gene expression was up to 9000-fold in the infected colon cancer tissue. CONCLUSION: VP16 transactivator-mediated and doxycycline-regulated expression of the human interleukin-12 gene enables highly efficient and tightly controlled cytokine expression in human cancer. These data illustrate the potential of the described adenoviral vector system for the safe and superior expression of therapeutic genes in the treatment of colorectal cancer and other malignancies. [Abstract/Link to Full Text]

De Mey M, Maertens J, Lequeux GJ, Soetaert WK, Vandamme EJ
Construction and model-based analysis of a promoter library for E. coli: an indispensable tool for metabolic engineering.
BMC Biotechnol. 2007;734.
BACKGROUND: Nowadays, the focus in metabolic engineering research is shifting from massive overexpression and inactivation of genes towards the model-based fine tuning of gene expression. In this context, the construction of a library of synthetic promoters of Escherichia coli as a useful tool for fine tuning gene expression is discussed here. RESULTS: A degenerated oligonucleotide sequence that encodes consensus sequences for E. coli promoters separated by spacers of random sequences has been designed and synthesized. This 57 bp long sequence contains 24 conserved, 13 semi-conserved (W, R and D) and 20 random nucleotides. This mixture of DNA fragments was cloned into a promoter probing vector (pVIK165). The ligation mixtures were transformed into competent E. coli MA8 and the resulting clones were screened for GFP activity by measuring the relative fluorescence units; some clones produced high fluorescence intensity, others weak fluorescence intensity. The clones cover a range of promoter activities from 21.79 RFU/OD600 ml to 7606.83 RFU/OD600 ml. 57 promoters were sequenced and used for promoter analysis. The present results conclusively show that the postulates, which link promoter strength to anomalies in the -10 box and/or -35 box, and to the length of the spacer, are not generally valid. However, by applying Partial Least Squares regression, a model describing the promoter strength was built and validated. CONCLUSION: For Escherichia coli, the promoter strength can not been linked to anomalies in the -10 box and/or -35 box, and to the length of the spacer. Also a probabilistic approach to relate the promoter sequence to its strength has some drawbacks. However, by applying Partial Least Squares regression, a good correlation was found between promoter sequence and promoter strength. This PLS model can be a useful tool to rationally design a suitable promoter in order to fine tune gene expression. [Abstract/Link to Full Text]

Dmytruk KV, Smutok OV, Ryabova OB, Gayda GZ, Sibirny VA, Schuhmann W, Gonchar MV, Sibirny AA
Isolation and characterization of mutated alcohol oxidases from the yeast Hansenula polymorpha with decreased affinity toward substrates and their use as selective elements of an amperometric biosensor.
BMC Biotechnol. 2007;733.
BACKGROUND: Accurate, rapid, and economic on-line analysis of ethanol is very desirable. However, available biosensors achieve saturation at very low ethanol concentrations and thus demand the time and labour consuming procedure of sample dilution. RESULTS: Hansenula polymorpha (Pichia angusta) mutant strains resistant to allyl alcohol in methanol medium were selected. Such strains possessed decreased affinity of alcohol oxidase (AOX) towards methanol: the KM values for AOX of wild type and mutant strains CA2 and CA4 are shown to be 0.62, 2.48 and 1.10 mM, respectively, whereas Vmax values are increased or remain unaffected. The mutant AOX alleles from H. polymorpha mutants CA2 and CA4 were isolated and sequenced. Several point mutations in the AOX gene, mostly different between the two mutant alleles, have been identified. Mutant AOX forms were isolated and purified, and some of their biochemical properties were studied. An amperometric biosensor based on the mutated form of AOX from the strain CA2 was constructed and revealed an extended linear response to the target analytes, ethanol and formaldehyde, as compared to the sensor based on the native AOX. CONCLUSION: The described selection methodology opens up the possibility of isolating modified forms of AOX with further decreased affinity toward substrates without reduction of the maximal velocity of reaction. It can help in creation of improved ethanol biosensors with a prolonged linear response towards ethanol in real samples of wines, beers or fermentation liquids. [Abstract/Link to Full Text]

de Marco A, Deuerling E, Mogk A, Tomoyasu T, Bukau B
Chaperone-based procedure to increase yields of soluble recombinant proteins produced in E. coli.
BMC Biotechnol. 2007;732.
BACKGROUND: The overproduction of recombinant proteins in host cells often leads to their misfolding and aggregation. Previous attempts to increase the solubility of recombinant proteins by co-overproduction of individual chaperones were only partially successful. We now assessed the effects of combined overproduction of the functionally cooperating chaperone network of the E. coli cytosol on the solubility of recombinant proteins. RESULTS: A two-step procedure was found to show the strongest enhancement of solubility. In a first step, the four chaperone systems GroEL/GroES, DnaK/DnaJ/GrpE, ClpB and the small HSPs IbpA/IbpB, were coordinately co-overproduced with recombinant proteins to optimize de novo folding. In a second step, protein biosynthesis was inhibited to permit chaperone mediated refolding of misfolded and aggregated proteins in vivo. This novel strategy increased the solubility of 70% of 64 different heterologous proteins tested up to 42-fold. CONCLUSION: The engineered E. coli strains and the two-step procedure presented here led to a remarkable increase in the solubility of a various recombinant proteins and should be applicable to a wide range of target proteins produced in biotechnology. [Abstract/Link to Full Text]

Frey D, Kambach C, Steinmetz MO, Jaussi R
Production of in vitro amplified DNA pseudolibraries and high-throughput cDNA target amplification.
BMC Biotechnol. 2007;731.
BACKGROUND: Many structural biology- and high-throughput laboratories experience the acquisition of multiple cDNAs from different sources as a rather time- and resource-consuming procedure. The techniques presented here solve these problems. RESULTS: An advanced target cDNA amplification procedure employing RNA- or cDNA-derived pseudolibraries circumvents the usual DNA transfection during library establishment. A small sample of reverse transcribed ss- or ds-cDNA or DNA from a pre-existing library is multiplied by in vitro rolling circle ramification amplification. The resulting cDNA pseudolibrary serves as a template for numerous highly efficient PCR amplifications and permits production and analysis of target cDNAs on an automated liquid handling workstation. CONCLUSION: The overall efficiency of the simple protocol collection approaches 100% for targets from libraries with low complexity such as Drosophila and yields >80% of amplicons up to 3 kb size in the case of human cDNA. [Abstract/Link to Full Text]

Odörfer KI, Unger NJ, Weber K, Sandgren EP, Erben RG
Marker tolerant, immunocompetent animals as a new tool for regenerative medicine and long-term cell tracking.
BMC Biotechnol. 2007;730.
BACKGROUND: Immune-mediated rejection of labeled cells is a general problem in transplantation studies using cells labeled with any immunogenic marker, and also in gene therapy protocols. The aim of this study was to establish a syngeneic model for long-term histological cell tracking in the absence of immune-mediated rejection of labeled cells in immunocompetent animals. We used inbred transgenic Fischer 344 rats expressing human placental alkaline phosphatase (hPLAP) under the control of the ubiquitous R26 promoter for this study. hPLAP is an excellent marker enzyme, providing superb histological detection quality in paraffin and plastic sections. RESULTS: Transplantation of cells from hPLAP transgenic (hPLAP-tg) F344 rats into wild-type (WT) F344 recipients failed because of immune-mediated rejection. Here we show that this problem can be overcome by inducing tolerance to the marker gene by transplantation of bone marrow from hPLAP-tg F344 rats into WT F344 hosts after lethal irradiation, or by neonatal exposure of WT F344 rats to hPLAP-tg F344 cells. As proof-of-principle, we injected bone marrow cells (BMC) from hPLAP-tg rats into the knee joint of marker tolerant, bone marrow-transplanted WT rats, and found successful engraftment and differentiation of donor cells. In addition, hPLAP-tg BMC injected intravenously in neonatally tolerized WT F344 hosts could be traced in lymph nodes, 2 months post-injection. CONCLUSION: In combination with the excellent marker hPLAP, marker tolerant animals may open up new perspectives for all experiments requiring long-term histological tracking of genetically labeled cells. [Abstract/Link to Full Text]

---

Recent Articles in Journal of Nanobiotechnology

---

Berkane E, Orlik F, Charbit A, Danelon C, Fournier D, Benz R, Winterhalter M
Nanopores: maltoporin channel as a sensor for maltodextrin and lambda-phage.
J Nanobiotechnology. 2005 Mar 2;3(1):3.
BACKGROUND: To harvest nutrition from the outside bacteria e.g. E. coli developed in the outer cell wall a number of sophisticated channels called porins. One of them, maltoporin, is a passive specific channel for the maltodextrin uptake. This channel was also named LamB as the bacterial virus phage Lambda mis-uses this channel to recognise the bacteria. The first step is a reversible binding followed after a lag phase by DNA injection. To date little is known about the binding capacity and less on the DNA injection mechanism. To elucidate the mechanism and to show the sensitivity of our method we reconstituted maltoporin in planar lipid membranes. Application of an external transmembrane electric field causes an ion current across the channel. Maltoporin channel diameter is around a few Angstroem. At this size the ion current is extremely sensitive to any modification of the channels surface. Protein conformational changes, substrate binding etc will cause fluctuations reflecting the molecular interactions with the channel wall. The recent improvement in ion current fluctuation analysis allows now studying the interaction of solutes with the channel on a single molecular level. RESULTS: We could demonstrate the asymmetry of the bacterial phage Lambda binding to its natural receptor maltoporin. CONCLUSION: We suggest that this type of measurement can be used as a new type of biosensors. [Abstract/Link to Full Text]

Zheng Y, Footz T, Manage DP, Backhouse CJ
Rapid self-assembly of DNA on a microfluidic chip.
J Nanobiotechnology. 2005 Feb 18;3(1):2.
BACKGROUND: DNA self-assembly methods have played a major role in enabling methods for acquiring genetic information without having to resort to sequencing, a relatively slow and costly procedure. However, even self-assembly processes tend to be very slow when they rely upon diffusion on a large scale. Miniaturisation and integration therefore hold the promise of greatly increasing this speed of operation. RESULTS: We have developed a rapid method for implementing the self-assembly of DNA within a microfluidic system by electrically extracting the DNA from an environment containing an uncharged denaturant. By controlling the parameters of the electrophoretic extraction and subsequent analysis of the DNA we are able to control when the hybridisation occurs as well as the degree of hybridisation. By avoiding off-chip processing or long thermal treatments we are able to perform this hybridisation rapidly and can perform hybridisation, sizing, heteroduplex analysis and single-stranded conformation analysis within a matter of minutes. The rapidity of this analysis allows the sampling of transient effects that may improve the sensitivity of mutation detection. CONCLUSIONS: We believe that this method will aid the integration of self-assembly methods upon microfluidic chips. The speed of this analysis also appears to provide information upon the dynamics of the self-assembly process. [Abstract/Link to Full Text]

Kouassi GK, Irudayaraj J, McCarty G
Examination of Cholesterol oxidase attachment to magnetic nanoparticles.
J Nanobiotechnology. 2005 Jan 20;3(1):1.
Magnetic nanoparticles (Fe3O4) were synthesized by thermal co-precipitation of ferric and ferrous chlorides. The sizes and structure of the particles were characterized using transmission electron microscopy (TEM). The size of the particles was in the range between 9.7 and 56.4 nm. Cholesterol oxidase (CHO) was successfully bound to the particles via carbodiimide activation. FTIR spectroscopy was used to confirm the binding of CHO to the particles. The binding efficiency was between 98 and 100% irrespective of the amount of particles used. Kinetic studies of the free and bound CHO revealed that the stability and activity of the enzyme were significantly improved upon binding to the nanoparticles. Furthermore, the bound enzyme exhibited a better tolerance to pH, temperature and substrate concentration. The activation energy for free and bound CHO was 13.6 and 9.3 kJ/mol, respectively. This indicated that the energy barrier of CHO activity was reduced upon binding onto Fe3O4 nanoparticles. The improvements observed in activity, stability, and functionality of CHO resulted from structural and conformational changes of the bound enzyme. The study indicates that the stability and activity of CHO could be enhanced via attachment to magnetic nanoparticles and subsequently will contribute to better uses of this enzyme in various biological and clinical applications. [Abstract/Link to Full Text]

Hoet PH, Brüske-Hohlfeld I, Salata OV
Nanoparticles - known and unknown health risks.
J Nanobiotechnology. 2004 Dec 8;2(1):12.
Manmade nanoparticles range from the well-established multi-ton production of carbon black and fumed silica for applications in plastic fillers and car tyres to microgram quantities of fluorescent quantum dots used as markers in biological imaging. As nano-sciences are experiencing massive investment worldwide, there will be a further rise in consumer products relying on nanotechnology. While benefits of nanotechnology are widely publicised, the discussion of the potential effects of their widespread use in the consumer and industrial products are just beginning to emerge. This review provides comprehensive analysis of data available on health effects of nanomaterials. [Abstract/Link to Full Text]

Yasuda K
Biotechnology approach to determination of genetic and epigenetic control in cells.
J Nanobiotechnology. 2004 11 22;2(1):11.
A series of studies aimed at developing methods and systems for analyzing epigenetic information in cells are presented. The role of the epigenetic information of cells, which is complementary to their genetic information, was inferred by comparing the predictions of genetic information with the cell behaviour observed under conditions chosen to reveal adaptation processes and community effects. Analysis of epigenetic information was developed starting from the twin complementary viewpoints of cells regulation as an 'algebraic' system (emphasis on the temporal aspect) and as a 'geometric' system (emphasis on the spatial aspect). The knowlege acquired from this study will lead to the use of cells for fully controlled practical applications like cell-based drug screening and the regeneration of organs. [Abstract/Link to Full Text]

Boevé JL, Ducarme V, Mertens T, Bouillard P, Angeli S
Surface structure, model and mechanism of an insect integument adapted to be damaged easily.
J Nanobiotechnology. 2004 10 1;2(1):10.
BACKGROUND: Several sawfly larvae of the Tenthredinidae (Hymenoptera) are called easy bleeders because their whole body integument, except the head capsule, disrupts very easily at a given spot, under a slight mechanical stress at this spot. The exuding haemolymph droplet acts as a feeding deterrent towards invertebrate predators. The present study aimed to describe the cuticle surface, to consider it from a mechanistic point of view, and to discuss potential consequences of the integument surface in the predator-prey relationships. RESULTS: The integument surface of sawfly larvae was investigated by light microscopy (LM) and scanning electron microscopy (SEM) which revealed that the cuticle of easy bleeders was densely covered by what we call "spider-like" microstructures. Such microstructures were not detected in non-easy bleeders. A model by finite elements of the cuticle layer was developed to get an insight into the potential function of the microstructures during easy bleeding. Cuticle parameters (i.e., size of the microstructures and thickness of the epi-versus procuticle) were measured on integument sections and used in the model. A shear force applied on the modelled cuticle surface led to higher stress values when microstructures were present, as compared to a plan surface. Furthermore, by measuring the diameter of a water droplet deposited on sawfly larvae, the integument of several sawfly species was determined as hydrophobic (e.g., more than Teflon(R)), which was related to the sawfly larvae's ability to bleed easily. CONCLUSION: Easy bleeders show spider-like microstructures on their cuticle surface. It is suggested that these microstructures may facilitate integument disruption as well as render the integument hydrophobic. This latter property would allow the exuding haemolymph to be maintained as a droplet at the integument surface. [Abstract/Link to Full Text]

Kojima K, Kaneko T, Yasuda K
A novel method of cultivating cardiac myocytes in agarose microchamber chips for studying cell synchronization.
J Nanobiotechnology. 2004 Sep 9;2(1):9.
We have developed a new method that enables agar microstructures to be used to cultivate cardiac myocyte cells in a manner that allows their connection patterns to be controlled. Non-contact three-dimensional photo-thermal etching with a 1064-nm infrared focused laser beam was used to form the shapes of agar microstructures. This wavelength was selected as it is not absorbed by water or agar. Identical rat cardiac myocytes were cultured in adjacent microstructures connected by microchannels and the interactions of asynchronous beating cardiac myocyte cells observed. Two isolated and independently beating cardiac myocytes were shown to form contacts through the narrow microchannels and by 90 minutes had synchronized their oscillations. This occurred by one of the two cells stopping their oscillation and following the pattern of the other cell. In contrast, when two sets of synchronized beating cells came into contact, those two sets synchronized without any observable interruptions to their rhythms. The results indicate that the synchronization process of cardiac myocytes may be dependent on the community size and network pattern of these cells. [Abstract/Link to Full Text]

Pennadam SS, Firman K, Alexander C, Górecki DC
Protein-polymer nano-machines. Towards synthetic control of biological processes.
J Nanobiotechnology. 2004 Sep 6;2(1):8.
The exploitation of nature's machinery at length scales below the dimensions of a cell is an exciting challenge for biologists, chemists and physicists, while advances in our understanding of these biological motifs are now providing an opportunity to develop real single molecule devices for technological applications. Single molecule studies are already well advanced and biological molecular motors are being used to guide the design of nano-scale machines. However, controlling the specific functions of these devices in biological systems under changing conditions is difficult. In this review we describe the principles underlying the development of a molecular motor with numerous potential applications in nanotechnology and the use of specific synthetic polymers as prototypic molecular switches for control of the motor function. The molecular motor is a derivative of a TypeI Restriction-Modification (R-M) enzyme and the synthetic polymer is drawn from the class of materials that exhibit a temperature-dependent phase transition.The potential exploitation of single molecules as functional devices has been heralded as the dawn of new era in biotechnology and medicine. It is not surprising, therefore, that the efforts of numerous multidisciplinary teams 12. have been focused in attempts to develop these systems. as machines capable of functioning at the low sub-micron and nanometre length-scales 3. However, one of the obstacles for the practical application of single molecule devices is the lack of functional control methods in biological media, under changing conditions. In this review we describe the conceptual basis for a molecular motor (a derivative of a TypeI Restriction-Modification enzyme) with numerous potential applications in nanotechnology and the use of specific synthetic polymers as prototypic molecular switches for controlling the motor function 4. [Abstract/Link to Full Text]

Suzuki I, Sugio Y, Moriguchi H, Jimbo Y, Yasuda K
Modification of a neuronal network direction using stepwise photo-thermal etching of an agarose architecture.
J Nanobiotechnology. 2004 Jul 1;2(1):7.
Control over spatial distribution of individual neurons and the pattern of neural network provides an important tool for studying information processing pathways during neural network formation. Moreover, the knowledge of the direction of synaptic connections between cells in each neural network can provide detailed information on the relationship between the forward and feedback signaling. We have developed a method for topographical control of the direction of synaptic connections within a living neuronal network using a new type of individual-cell-based on-chip cell-cultivation system with an agarose microchamber array (AMCA). The advantages of this system include the possibility to control positions and number of cultured cells as well as flexible control of the direction of elongation of axons through stepwise melting of narrow grooves. Such micrometer-order microchannels are obtained by photo-thermal etching of agarose where a portion of the gel is melted with a 1064-nm infrared laser beam. Using this system, we created neural network from individual Rat hippocampal cells. We were able to control elongation of individual axons during cultivation (from cells contained within the AMCA) by non-destructive stepwise photo-thermal etching. We have demonstrated the potential of our on-chip AMCA cell cultivation system for the controlled development of individual cell-based neural networks. [Abstract/Link to Full Text]

Lee JW, Ng ML
A nano-view of West Nile virus-induced cellular changes during infection.
J Nanobiotechnology. 2004 Jun 29;2(1):6.
BACKGROUND: Microscopic imaging of viruses and their interactions with and effects on host cells are frequently held back by limitations of the microscope's resolution or the invasive nature of the sample preparation procedures. It is also difficult to have a technique that would allow simultaneous imaging of both surface and sub-surface on the same cell. This has hampered endeavours to elucidate virus-host interactions. Atomic Force Microscopy (AFM), which is commonly used in the physical sciences, is now becoming a good correlative form of microscopy used to complement existing optical, confocal and electron microscopy for biological applications RESULTS: In this study, the West Nile (Sarafend) virus-infected Vero cell model was used. The atomic force microscope was found to be useful in producing high resolution images of virus-host events with minimal sample processing requirements. The AFM was able to image the budding of the West Nile (Sarafend) virus at the infected cell surface. Proliferation of the filopodia and thickening of clusters of actin filaments accompanied West Nile virus replication. CONCLUSIONS: The study shows that the AFM is useful for virus-host interaction studies. The technique provides morphological information on both the virus and the host cell during the infection stages. [Abstract/Link to Full Text]

Takahashi K, Hattori A, Suzuki I, Ichiki T, Yasuda K
Non-destructive on-chip cell sorting system with real-time microscopic image processing.
J Nanobiotechnology. 2004 Jun 3;2(1):5.
Studying cell functions for cellomics studies often requires the use of purified individual cells from mixtures of various kinds of cells. We have developed a new non-destructive on-chip cell sorting system for single cell based cultivation, by exploiting the advantage of microfluidics and electrostatic force. The system consists of the following two parts: a cell sorting chip made of poly-dimethylsiloxane (PDMS) on a 0.2-mm-thick glass slide, and an image analysis system with a phase-contrast/fluorescence microscope. The unique features of our system include (i) identification of a target from sample cells is achieved by comparison of the 0.2-microm-resolution phase-contrast and fluorescence images of cells in the microchannel every 1/30 s; (ii) non-destructive sorting of target cells in a laminar flow by application of electrostatic repulsion force for removing unrequited cells from the one laminar flow to the other; (iii) the use of agar gel for electrodes in order to minimize the effect on cells by electrochemical reactions of electrodes, and (iv) pre-filter, which was fabricated within the channel for removal of dust contained in a sample solution from tissue extracts. The sorting chip is capable of continuous operation and we have purified more than ten thousand cells for cultivation without damaging them. Our design has proved to be very efficient and suitable for the routine use in cell purification experiments. [Abstract/Link to Full Text]

Salata O
Applications of nanoparticles in biology and medicine.
J Nanobiotechnology. 2004 Apr 30;2(1):3.
Nanomaterials are at the leading edge of the rapidly developing field of nanotechnology. Their unique size-dependent properties make these materials superior and indispensable in many areas of human activity. This brief review tries to summarise the most recent developments in the field of applied nanomaterials, in particular their application in biology and medicine, and discusses their commercialisation prospects. [Abstract/Link to Full Text]

Inoue I, Shiomi D, Kawagishi I, Yasuda K
Simultaneous measurement of sensor-protein dynamics and motility of a single cell by on-chip microcultivation system.
J Nanobiotechnology. 2004 Apr 30;2(1):4.
Measurement of the correlation between sensor-protein expression, motility and environmental change is important for understanding the adaptation process of cells during their change of generation. We have developed a novel assay exploiting the on-chip cultivation system, which enabled us to observe the change of the localization of expressed sensor-protein and the motility for generations. Localization of the aspartate sensitive sensor protein at two poles in Escherichia coli decreased quickly after the aspartate was added into the cultivation medium. However, it took more than three generations for recovering the localization after the removal of aspartate from the medium. Moreover, the tumbling frequency was strongly related to the localization of the sensor protein in a cell. The results indicate that the change of the spatial localization of sensor protein, which was inherited for more than three generations, may contribute to cells, motility as the inheritable information. [Abstract/Link to Full Text]

Barry R, Ivanov D
Microfluidics in biotechnology.
J Nanobiotechnology. 2004 Mar 31;2(1):2.
Microfluidics enables biotechnological processes to proceed on a scale (microns) at which physical processes such as osmotic movement, electrophoretic-motility and surface interactions become enhanced. At the microscale sample volumes and assay times are reduced, and procedural costs are lowered. The versatility of microfluidic devices allows interfacing with current methods and technologies. Microfluidics has been applied to DNA analysis methods and shown to accelerate DNA microarray assay hybridisation times. The linking of microfluidics to protein analysis techologies, e.g. mass spectrometry, enables picomole amounts of peptide to be analysed within a controlled micro-environment. The flexibility of microfluidics will facilitate its exploitation in assay development across multiple biotechnological disciplines. [Abstract/Link to Full Text]

Ishay JS, Pertsis V, Neufeld A, Bergman DJ
Subcuticular microstructure of the hornet's gaster: Its possible function in thermoregulation.
J Nanobiotechnology. 2004 Jan 11;2(1):1.
The present study set out to elucidate the structure and function of the large subcuticular air sacs encountered in the gaster of the Oriental hornet Vespa orientalis (Hymenoptera, Vespinae). Gastral segments I, II, III, together with the anterior portion of segment IV, comprise the greater volume of the gaster, and inside them, beneath the cuticle, are contained not only structures that extend throughout their entire length, like the alimentary canal, and the nerve cord with its paired abdominal ganglia, situated near the cuticle in the ventral side, but also the heart, which is actually a muscular and dorsally located blood vessel that pumps blood anteriorly, toward the head of the hornet. The mentioned structures take up only a small volume of the gaster, while the rest is occupied by air sacs and tracheal ducts that also extend longitudinally. Interposed between the two air sacs, there is a hard partition and above it, at the center - a paired tracheal duct that extends the entire length of the air sacs. The endothelium of the air sacs is very anfractuous, thereby enlarging and strengthening the surface area. In each gastral segment there is an aperture for the entry of air, namely, a spiracle. Additionally, in each segment, in the antero-lateral aspect of its tergum and situated between two successive segments, there is an intersegmental conjunctive bearing parallel slits of 1-2 microM in width and 10-30 microM in length. The latter are arranged concentrically around bundles of tracheae that traverse the cuticle from segment to segment. From the upper rims of the slits are suspended downward fringe-like structures or "shutters" ranging between 3-10 microM in length. We discuss the possibility that the Oriental hornet resorts to internal circulation of air, along with a thermoelectric heat pump mechanism, in order to achieve cooling and thermoregulation of its body. [Abstract/Link to Full Text]

Ricca E, Cutting SM
Emerging Applications of Bacterial Spores in Nanobiotechnology.
J Nanobiotechnology. 2003 Dec 15;1(1):6.
Bacterial spores are robust and dormant life forms with formidable resistance properties, in part, attributable to the multiple layers of protein that encase the spore in a protective and flexible shield. The coat has a number of features pertinent to the emerging field of nanobiotechnology including self-assembling protomers and the capacity for engineering and delivery of foreign molecules. This review gives an account of recent progress describing the use of the spore, and specifically, the spore coat as a vehicle for heterologous antigen presentation and protective immunization (vaccination). As interest in the spore coat increases it seems likely that they will be exploited further for drug and enzyme delivery as well as a source of novel self-assembling proteins. [Abstract/Link to Full Text]

Peabody DS
A Viral Platform for Chemical Modification and Multivalent Display.
J Nanobiotechnology. 2003 Jul 15;1(1):5.
The ability to chemically modify the surfaces of viruses and virus-like particles makes it possible to confer properties that make them potentially useful in biotechnology, nanotechnology and molecular electronics applications. RNA phages (e.g. MS2) have characteristics that make them suitable scaffolds to which a variety of substances could be chemically attached in definite geometric patterns. To provide for specific chemical modification of MS2's outer surface, cysteine residues were substituted for several amino acids present on the surface of the wild-type virus particle. Some substitutions resulted in coat protein folding or stability defects, but one allowed the production of an otherwise normal virus-like particle with an accessible sulfhydryl on its surface. [Abstract/Link to Full Text]

Soloviev M, Barry R, Scrivener E, Terrett J
Combinatorial peptidomics: a generic approach for protein expression profiling.
J Nanobiotechnology. 2003 Jul 3;1(1):4.
Traditional approaches to protein profiling were built around the concept of investigating one protein at a time and have long since reached their limits of throughput. Here we present a completely new approach for comprehensive compositional analysis of complex protein mixtures, capable of overcoming the deficiencies of current proteomics techniques. The Combinatorial methodology utilises the peptidomics approach, in which protein samples are proteolytically digested using one or a combination of proteases prior to any assay being carried out. The second fundamental principle is the combinatorial depletion of the crude protein digest (i.e. of the peptide pool) by chemical crosslinking through amino acid side chains. Our approach relies on the chemical reactivities of the amino acids and therefore the amino acid content of the peptides (i.e. their information content) rather than their physical properties. Combinatorial peptidomics does not use affinity reagents and relies on neither chromatography nor electrophoretic separation techniques. It is the first generic methodology applicable to protein expression profiling, that is independent of the physical properties of proteins and does not require any prior knowledge of the proteins. Alternatively, a specific combinatorial strategy may be designed to analyse a particular known protein on the basis of that protein sequence alone or, in the absence of reliable protein sequence, even the predicted amino acid translation of an EST sequence. Combinatorial peptidomics is especially suitable for use with high throughput micro- and nano-fluidic platforms capable of running multiple depletion reactions in a single disposable chip. [Abstract/Link to Full Text]

Stamps AC, Terrett JA, Adam PJ
Application of in situ reverse trancriptase-polymerase chain reaction (RT-PCR) to tissue microarrays.
J Nanobiotechnology. 2003 May 28;1(1):3.
Detection of disease-associated gene transcripts in primary disease tissues is frequently confounded by the presence of non-involved cell types. Alternative methods of detecting gene expression directly within tissues involve either the generation of antibodies, which can be a lengthy process and may suffer from lack of specificity, or amplification of reverse-transcribed cDNA in tissue sections (in situ RT-PCR). The latter method is highly specific and enables detection of transcripts in the cells originally responsible for their synthesis, but is highly destructive of tissue structures and can be carried out on only one or a few sections per experiment, resulting in low reproducibility. In this study, in situ RT-PCR was applied for the first time to commercially available tissue section microarrays enabling the examination of up to 70 different samples simultaneously. Modifications to the technique are detailed that preserved visible tissue and cellular structures and improved transcript detection whilst preventing significant generation of artefacts. [Abstract/Link to Full Text]

Fletcher G, Mason S, Terrett J, Soloviev M
Self-assembly of proteins and their nucleic acids.
J Nanobiotechnology. 2003 Jan 28;1(1):1.
We have developed an artificial protein scaffold, herewith called a protein vector, which allows linking of an in-vitro synthesised protein to the nucleic acid which encodes it through the process of self-assembly. This protein vector enables the direct physical linkage between a functional protein and its genetic code. The principle is demonstrated using a streptavidin-based protein vector (SAPV) as both a nucleic acid binding pocket and a protein display system. We have shown that functional proteins or protein domains can be produced in vitro and physically linked to their DNA in a single enzymatic reaction. Such self-assembled protein-DNA complexes can be used for protein cloning, the cloning of protein affinity reagents or for the production of proteins which self-assemble on a variety of solid supports. Self-assembly can be utilised for making libraries of protein-DNA complexes or for labelling the protein part of such a complex to a high specific activity by labelling the nucleic acid associated with the protein. In summary, self-assembly offers an opportunity to quickly generate cheap protein affinity reagents, which can also be efficiently labelled, for use in traditional affinity assays or for protein arrays instead of conventional antibodies. [Abstract/Link to Full Text]

Osada T, Uehara H, Kim H, Ikai A
mRNA analysis of single living cells.
J Nanobiotechnology. 2003 Feb 14;1(1):2.
Analysis of specific gene expression in single living cells may become an important technique for cell biology. So far, no method has been available to detect mRNA in living cells without killing or destroying them. We have developed here a novel method to examine gene expression of living cells using an atomic force microscope (AFM). AFM tip was inserted into living cells to extract mRNAs. The obtained mRNAs were analyzed with RT-PCR, nested PCR, and quantitative PCR. This method enabled us to examine time-dependent gene expression of single living cells without serious damage to the cells. [Abstract/Link to Full Text]

---

Recent Articles in BMC Medical Imaging

---

Rossi M, Cantisani V, Salvatori FM, Rebonato A, Greco L, Giglio L, Guido G, Pagliara E, David V
Histologic assessment of biliary obstruction with different percutaneous endoluminal techniques.
BMC Med Imaging. 2004 Aug 25;4(1):3.
BACKGROUND: Despite the sophisticated cross sectional image techniques currently available, a number of biliary stenosis or obstructions remain of an uncertain nature. In these pathological conditions, an "intrinsic" parietal alteration is the cause of biliary obstruction and it is very difficult to differentiate benign from malignant lesions using cross-sectional imaging procedures alone. We evaluated the efficacy of different endoluminal techniques to achieve a definitive pathological diagnosis in these situations. METHODS: Eighty patients underwent brushing, and or biopsy of the biliary tree through an existing transhepatic biliary drainage route. A subcoort of 12 patients needed balloon-dilatation of the bile duct and the material covering the balloon surface was also sent for pathological examination (balloon surface sampling). Pathological results were compared with surgical findings or with long-term clinical and instrumental follow-ups. Success rates, sensitivity, specificity, accuracy, confidential intervals, positive predictive value and negative predictive value of the three percutaneous techniques in differentiating benign from malignant disease were assessed.The agreement coefficient of biopsy and brushing with final diagnosis was calculated using the Cohen's "K" value. RESULTS: Fifty-six patients had malignant strictures confirmed by surgery, histology, and by clinical follow-ups. Success rates of brushing, balloon surface sampling, and biopsy were 90.7, 100, and 100%, respectively. The comparative efficacy of brushing, balloon-surface sampling, and biopsy resulted as follows: sensitivity of 47.8, 87.5, and 92.1%, respectively; specificity of 100% for all the techniques; accuracy of 69.2, 91.7 and 93.6%, Positive Predictive Value of 100% for all the procedures and Negative Predictive Value of 55, 80, and 75%, respectively. CONCLUSIONS: Percutaneous endoluminal biopsy is more accurate and sensitive than percutaneous bile duct brushing in the detection of malignant diseases (p < 0.01). [Abstract/Link to Full Text]

Ather MH, Jafri AH, Sulaiman MN
Diagnostic accuracy of ultrasonography compared to unenhanced CT for stone and obstruction in patients with renal failure.
BMC Med Imaging. 2004 Jul 29;4(1):2.
BACKGROUND: To determine accuracy of ultrasound (US) kidney, ureter and bladder (KUB) compared to un-enhanced helical CT (UHCT) in patients with renal failure in the diagnosis of stone and obstruction. METHODS: This is a case controlled study conducted in the period from June 2000 to July 2003 at a university hospital. All patients had both US and UHCT scan. Patients with serum creatinine >/= 1.8 mg/dl were included in the study. Only direct visualization of stone was considered as confirmatory. In both the studies, UHCT and US, presence of stone and obstruction were noted. The relevant biochemicals, radiological and clinical records of all the patients were analyzed. Data was analyzed using commercially available software. RESULTS: During the period of study 864 patients had UHCT for evaluation of the urinary tract in patients presenting with flank pain. Out of these 34 patients had both UHCT and US done within a span of one day and had serum creatinine of >/=1.8 mg/dl. Mean age was 48 +/-15.8 years and 59% of patients were males. UHCT identified renal stones in 21 (62%), whereas 17 of these were identified on US, with a sensitivity of 81%. Of the four patients with renal stones missed on US, three were identified on plain x-ray; the mean size of stones missed was 6.3 mm. Of the 22 (65%) patients with ureteric stone on UHCT, US could only identify 10; a further 7 were identified on x-ray KUB, giving a sensitivity of 45% (US alone) and 77% (US with x-ray KUB). CONCLUSIONS: US is sensitive and specific for renal stones, 81% and 100% and for hydronephrosis, 93% and 100%, respectively. Its sensitivity to pick ureteric stone (46%) and to identify hydroureter (50%) is low. Addition of x-ray KUB abdomen increases the sensitivity for ureteric stones to 77%. [Abstract/Link to Full Text]

Schisterman EF, Whitcomb BW
Coronary age as a risk factor in the modified Framingham risk score.
BMC Med Imaging. 2004 Apr 26;4(1):1.
BACKGROUND: Clinical guidelines emphasize risk assessment as vital to patient selection for medical primary intervention. However, risk assessment methods are restricted in their ability to predict further coronary events. The most widely accepted tool in the United States is the Framingham risk score. In these equations age is a powerful risk factor. Although the extent of coronary atherosclerosis increases with age, there is large inter-individual variability in the rate of development and progression of this disease. This fact limits the utility of Framingham scoring when applied to individuals. Electron beam tomography (EBT), which measures coronary calcium, provides a non-invasive method for assessing coronary plaque burden, thus offering the possibility of providing a more accurate estimate of an individual's "arterial age" than from chronological age alone. METHODS: In this paper we discuss a new and simple method for incorporating the coronary calcium score (CCS) to modify the Framingham Risk Assessment (FRA). Using this method, a coronary artery calcium (CAC) age equivalent is generated that replaces chronological age in Framingham scoring. RESULTS AND DISCUSSION: Using a percentile table of CCS scores by age group and sex, individuals are matched to the age group whose calcium score most closely approximates their own individual score. The original 10-year absolute risk score of a 65-year old man with a CCS of 6 based on chronological age is 10%, whereas the modified absolute risk score based on CAC age equivalents is 2%. CONCLUSION: Our approach of replacing chronological age with CAC age equivalents in the Framingham equations possesses simplicity of application combined with precision. Physicians can easily derive adjusted Framingham risk scores and prescribe intervention methods based on patients' ten-year risks. The adjusted ten-year risks are likely to be more accurate than unadjusted risks since they are based on coronary calcium score information. The modified FRA approach not only may increase the predicted risk for some patients, but also may decrease the predicted risk for others, making it a more precise adjustment than other methods. [Abstract/Link to Full Text]

Vlychou M, Georganas M, Spanomichos G, Kanavaros P, Artinopoulos C, Zavras GM
Angiographic findings and clinical implications of persistent primitive hypoglossal artery.
BMC Med Imaging. 2003 Jul 23;3(1):2.
BACKGROUND: The primitive hypoglossal artery (PHA) is a rare vascular anomaly, which belongs to the group of carotid-basilar anastomosis that may occur in adults. CASE PRESENTATION: Herein is presented a case of a patient with a PHA, who had undergone a cerebral angiography due to investigation of subarachnoid hemorrhage. Additionally, the diagnostic alternatives for detection and assessment of PHA and the spectrum of diseases related to its presence are discussed. CONCLUSIONS: The presence of a persistent PHA can be recognized as an incidental finding in a cerebral angiography without any other clinical implication or may be associated with certain clinical entities such as aneurysm formation and atherosclerotic disease. [Abstract/Link to Full Text]

Sinan T, Leven H, Sheikh M
Is fasting a necessary preparation for abdominal ultrasound?
BMC Med Imaging. 2003 Jul 22;3(1):1.
OBJECTIVE: To study the effect of fasting on the technical success of abdominal ultrasound examination. METHODS: In a randomized, prospective study, 150 patients for abdominal ultrasound were divided into two groups of 75 patients each with instructions to fast for six hours or have normal breakfast respectively. RESULT: The technical success of the abdominal ultrasound performed by radiologists blinded to the instruction did not differ significantly between the groups. CONCLUSION: It appears that routine fasting before abdominal ultrasound is not necessary. [Abstract/Link to Full Text]

Sinan T, Sheikh M, Ramadan S, Sahwney S, Behbehani A
CT features in abdominal tuberculosis: 20 years experience.
BMC Med Imaging. 2002 Nov 12;2(1):3.
BACKGROUND: Abdominal tuberculosis (TB) is endemic in the developing world and is reemerging in the West. Since computed tomography (CT) has the ability to demonstrate changes in the peritonium, mesentry, lymphnodes, bowel and solid organs and is being increasingly used for primary evaluation of abdominal conditions, it is important to be familiar with the CT features of the disease. METHODS: CT findings were retrospectively analysed in 49 patients with proved abdominal TB. Patients with genitourinary TB and with AIDS/HIV were not included in the study. RESULTS: Peritoneal involvement was the most common feature (77.5%) with ascites (wet peritonitis) seen in more than half the cases (55.2%). The rest showed peritoneal, mesenteric or omental thickening or mass formation but no ascites (dry peritonitis). Other findings included lymphadenopathy (46.9% mainly of diffuse nature, bowel wall thickening (38%) and solid organ involvement (20.4%). CONCLUSIONS: CT reliably demonstrates the entire range of findings which need interpretation in the light of clinical and laboratory data. [Abstract/Link to Full Text]

Nicolato E, Farace P, Asperio RM, Marzola P, Lunati E, Sbarbati A, Osculati F
Dynamic contrast-enhanced magnetic resonance imaging of the sarcopenic muscle.
BMC Med Imaging. 2002 Jun 5;2(1):2.
BACKGROUND: Studies about capillarity of the aged muscle provided conflicting results and no data are currently available about the magnetic resonance imaging (MRI) in vivo characteristics of the microvascular bed in aged rats. We have studied age-related modifications of the skeletal muscle by in vivo T2-relaxometry and dynamic contrast-enhanced magnetic resonance imaging (CE-MRI) at high field intensity (4.7 T). The aim of the work was to test the hypothesis that the ageing process involves microvessels in skeletal muscle. METHODS: The study was performed in 4-month-old (n = 6) and 20-month-old (n = 6) rats. RESULTS: At MRI examination, the relaxation time T2 of the gastrocnemius muscle showed no significant difference between these two groups. The kinetic of contrast penetration in the tissue showed that in 4-month-old rats the enhancement values of the signal intensity at different time-points were significantly higher than those found in senescent rats. CONCLUSION: The reported finding suggests that there is a modification of the microcirculatory function in skeletal muscle of aged rats. This work also demonstrates that CE-MRI allows for an in vivo quantification of the multiple biological processes involving the skeletal muscle during aging. Therefore, CE-MRI could represent a further tool for the follow up of tissue modification and therapeutic intervention both in patients with sarcopenia and in experimental models of this pathology. [Abstract/Link to Full Text]

Kutlu R, Gulcan O, Akbulut A, Turkoz R, Baysal T
Endovascular treatment of huge saccular abdominal aortic aneurysm in a young Behcet patient: mid-term result.
BMC Med Imaging. 2002 Mar 22;2(1):1.
BACKGROUND: Abdominal aortic aneurysm formation is among the arterial complications of Behcet's disease. Weakness and fragility of aortic walls leads to the development of arterial complications like pseudoaneurysms. CASE PRESENTATION: A case of huge saccular abdominal aortic aneurysm in a young Behcet patient who was successfully treated with endovascular stent graft placement is reported, diagnostic and interventional procedures are discussed, and mid-term follow-up results are presented. CONCLUSIONS: Endovascular treatment of abdominal aortic aneurysm complications of young Behcet patients who are not suitable for open surgery and need intervention could be an alternative treatment modality even without performing preprocedural angiography. [Abstract/Link to Full Text]

Swingler GH
Observer variation in chest radiography of acute lower respiratory infections in children: a systematic review.
BMC Med Imaging. 2001;1(1):1.
BACKGROUND: Knowledge of the accuracy of chest radiograph findings in acute lower respiratory infection in children is important when making clinical decisions. METHODS: I conducted a systematic review of agreement between and within observers in the detection of radiographic features of acute lower respiratory infections in children, and described the quality of the design and reporting of studies, whether included or excluded from the review.Included studies were those of observer variation in the interpretation of radiographic features of lower respiratory infection in children (neonatal nurseries excluded) in which radiographs were read independently and a clinical population was studied. I searched MEDLINE, HealthSTAR and HSRPROJ databases (1966 to 1999), handsearched the reference lists of identified papers and contacted authors of identified studies. I performed the data extraction alone. RESULTS: Ten studies of observer interpretation of radiographic features of lower respiratory infection in children were identified. Seven of the studies satisfied four or more of the seven design and reporting criteria. Six studies met the inclusion criteria for the review. Inter-observer agreement varied with the radiographic feature examined. Kappa statistics ranged from around 0.80 for individual radiographic features to 0.27-0.38 for bacterial vs viral etiology. CONCLUSIONS: Little information was identified on observer agreement on radiographic features of lower respiratory tract infections in children. Agreement varied with the features assessed from "fair" to "very good". Aspects of the quality of the methods and reporting need attention in future studies, particularly the description of criteria for radiographic features. [Abstract/Link to Full Text]

---

Recent Articles in Biomagnetic Research and Technology

---

No recent articles are currently available.